ID: 1186034829

View in Genome Browser
Species Human (GRCh38)
Location X:5411176-5411198
Sequence TCACCTTGTAACCACCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186034828_1186034829 -5 Left 1186034828 X:5411158-5411180 CCTTAAAATGGGTAGAACTCACC No data
Right 1186034829 X:5411176-5411198 TCACCTTGTAACCACCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186034829 Original CRISPR TCACCTTGTAACCACCTGAG AGG Intergenic
No off target data available for this crispr