ID: 1186040097

View in Genome Browser
Species Human (GRCh38)
Location X:5466518-5466540
Sequence TATTGAAGCCACACTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186040097_1186040100 -2 Left 1186040097 X:5466518-5466540 CCCAGTGCAGTGTGGCTTCAATA No data
Right 1186040100 X:5466539-5466561 TAAAGTCTGAAAAGAAAAGGTGG No data
1186040097_1186040099 -5 Left 1186040097 X:5466518-5466540 CCCAGTGCAGTGTGGCTTCAATA No data
Right 1186040099 X:5466536-5466558 CAATAAAGTCTGAAAAGAAAAGG No data
1186040097_1186040103 18 Left 1186040097 X:5466518-5466540 CCCAGTGCAGTGTGGCTTCAATA No data
Right 1186040103 X:5466559-5466581 TGGAGTTATTCAGAAGAATGGGG No data
1186040097_1186040102 17 Left 1186040097 X:5466518-5466540 CCCAGTGCAGTGTGGCTTCAATA No data
Right 1186040102 X:5466558-5466580 GTGGAGTTATTCAGAAGAATGGG No data
1186040097_1186040101 16 Left 1186040097 X:5466518-5466540 CCCAGTGCAGTGTGGCTTCAATA No data
Right 1186040101 X:5466557-5466579 GGTGGAGTTATTCAGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186040097 Original CRISPR TATTGAAGCCACACTGCACT GGG (reversed) Intergenic
No off target data available for this crispr