ID: 1186040098

View in Genome Browser
Species Human (GRCh38)
Location X:5466519-5466541
Sequence TTATTGAAGCCACACTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186040098_1186040101 15 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040101 X:5466557-5466579 GGTGGAGTTATTCAGAAGAATGG No data
1186040098_1186040103 17 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040103 X:5466559-5466581 TGGAGTTATTCAGAAGAATGGGG No data
1186040098_1186040100 -3 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040100 X:5466539-5466561 TAAAGTCTGAAAAGAAAAGGTGG No data
1186040098_1186040102 16 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040102 X:5466558-5466580 GTGGAGTTATTCAGAAGAATGGG No data
1186040098_1186040099 -6 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040099 X:5466536-5466558 CAATAAAGTCTGAAAAGAAAAGG No data
1186040098_1186040104 30 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040104 X:5466572-5466594 AAGAATGGGGTGACAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186040098 Original CRISPR TTATTGAAGCCACACTGCAC TGG (reversed) Intergenic
No off target data available for this crispr