ID: 1186040101

View in Genome Browser
Species Human (GRCh38)
Location X:5466557-5466579
Sequence GGTGGAGTTATTCAGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186040098_1186040101 15 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040101 X:5466557-5466579 GGTGGAGTTATTCAGAAGAATGG No data
1186040094_1186040101 28 Left 1186040094 X:5466506-5466528 CCCTGAACACTTCCCAGTGCAGT No data
Right 1186040101 X:5466557-5466579 GGTGGAGTTATTCAGAAGAATGG No data
1186040097_1186040101 16 Left 1186040097 X:5466518-5466540 CCCAGTGCAGTGTGGCTTCAATA No data
Right 1186040101 X:5466557-5466579 GGTGGAGTTATTCAGAAGAATGG No data
1186040095_1186040101 27 Left 1186040095 X:5466507-5466529 CCTGAACACTTCCCAGTGCAGTG No data
Right 1186040101 X:5466557-5466579 GGTGGAGTTATTCAGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186040101 Original CRISPR GGTGGAGTTATTCAGAAGAA TGG Intergenic
No off target data available for this crispr