ID: 1186040104

View in Genome Browser
Species Human (GRCh38)
Location X:5466572-5466594
Sequence AAGAATGGGGTGACAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186040098_1186040104 30 Left 1186040098 X:5466519-5466541 CCAGTGCAGTGTGGCTTCAATAA No data
Right 1186040104 X:5466572-5466594 AAGAATGGGGTGACAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186040104 Original CRISPR AAGAATGGGGTGACAGTGAG AGG Intergenic
No off target data available for this crispr