ID: 1186046358

View in Genome Browser
Species Human (GRCh38)
Location X:5541140-5541162
Sequence TCTTACCTCTATCAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186046358_1186046361 8 Left 1186046358 X:5541140-5541162 CCTTCCATCTGATAGAGGTAAGA No data
Right 1186046361 X:5541171-5541193 AATCTGAGTTTATTTTGCCAAGG No data
1186046358_1186046362 14 Left 1186046358 X:5541140-5541162 CCTTCCATCTGATAGAGGTAAGA No data
Right 1186046362 X:5541177-5541199 AGTTTATTTTGCCAAGGTTGAGG 0: 414
1: 804
2: 870
3: 582
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186046358 Original CRISPR TCTTACCTCTATCAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr