ID: 1186047573

View in Genome Browser
Species Human (GRCh38)
Location X:5552653-5552675
Sequence TGCAGGGAACTCTCCAGTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186047566_1186047573 2 Left 1186047566 X:5552628-5552650 CCCTGTTGCACGTCTTGCCAGGG No data
Right 1186047573 X:5552653-5552675 TGCAGGGAACTCTCCAGTTTCGG No data
1186047562_1186047573 20 Left 1186047562 X:5552610-5552632 CCAAACAGAGAGCCACACCCCTG No data
Right 1186047573 X:5552653-5552675 TGCAGGGAACTCTCCAGTTTCGG No data
1186047563_1186047573 8 Left 1186047563 X:5552622-5552644 CCACACCCCTGTTGCACGTCTTG No data
Right 1186047573 X:5552653-5552675 TGCAGGGAACTCTCCAGTTTCGG No data
1186047568_1186047573 1 Left 1186047568 X:5552629-5552651 CCTGTTGCACGTCTTGCCAGGGG No data
Right 1186047573 X:5552653-5552675 TGCAGGGAACTCTCCAGTTTCGG No data
1186047564_1186047573 3 Left 1186047564 X:5552627-5552649 CCCCTGTTGCACGTCTTGCCAGG No data
Right 1186047573 X:5552653-5552675 TGCAGGGAACTCTCCAGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186047573 Original CRISPR TGCAGGGAACTCTCCAGTTT CGG Intergenic