ID: 1186051021

View in Genome Browser
Species Human (GRCh38)
Location X:5595722-5595744
Sequence CTCTGTTCTCTTTACAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186051014_1186051021 28 Left 1186051014 X:5595671-5595693 CCAGGCAGACCACAGAGGATGAC No data
Right 1186051021 X:5595722-5595744 CTCTGTTCTCTTTACAAGTTTGG No data
1186051015_1186051021 19 Left 1186051015 X:5595680-5595702 CCACAGAGGATGACTTTATTACA No data
Right 1186051021 X:5595722-5595744 CTCTGTTCTCTTTACAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186051021 Original CRISPR CTCTGTTCTCTTTACAAGTT TGG Intergenic
No off target data available for this crispr