ID: 1186057506

View in Genome Browser
Species Human (GRCh38)
Location X:5665607-5665629
Sequence TGGGACTCTTGGGCAAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186057506_1186057518 28 Left 1186057506 X:5665607-5665629 CCCGCTTTTGCCCAAGAGTCCCA No data
Right 1186057518 X:5665658-5665680 CCATCACCAGAGCGAGGTGGAGG No data
1186057506_1186057513 22 Left 1186057506 X:5665607-5665629 CCCGCTTTTGCCCAAGAGTCCCA No data
Right 1186057513 X:5665652-5665674 TCCCAGCCATCACCAGAGCGAGG No data
1186057506_1186057516 25 Left 1186057506 X:5665607-5665629 CCCGCTTTTGCCCAAGAGTCCCA No data
Right 1186057516 X:5665655-5665677 CAGCCATCACCAGAGCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186057506 Original CRISPR TGGGACTCTTGGGCAAAAGC GGG (reversed) Intergenic
No off target data available for this crispr