ID: 1186057965

View in Genome Browser
Species Human (GRCh38)
Location X:5671602-5671624
Sequence CTTTATTAGCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186057965_1186057970 14 Left 1186057965 X:5671602-5671624 CCATTCTCATTCTGCTAATAAAG No data
Right 1186057970 X:5671639-5671661 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
1186057965_1186057967 -6 Left 1186057965 X:5671602-5671624 CCATTCTCATTCTGCTAATAAAG No data
Right 1186057967 X:5671619-5671641 ATAAAGACATACCTGAGACTGGG 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
1186057965_1186057969 7 Left 1186057965 X:5671602-5671624 CCATTCTCATTCTGCTAATAAAG No data
Right 1186057969 X:5671632-5671654 TGAGACTGGGTAATTTATAAAGG 0: 1925
1: 3198
2: 4070
3: 3254
4: 1860
1186057965_1186057966 -7 Left 1186057965 X:5671602-5671624 CCATTCTCATTCTGCTAATAAAG No data
Right 1186057966 X:5671618-5671640 AATAAAGACATACCTGAGACTGG 0: 1097
1: 3639
2: 7030
3: 10378
4: 10910

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186057965 Original CRISPR CTTTATTAGCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr