ID: 1186066914

View in Genome Browser
Species Human (GRCh38)
Location X:5776223-5776245
Sequence GGGTATACCCCTTGTATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186066914_1186066919 11 Left 1186066914 X:5776223-5776245 CCCAACATACAAGGGGTATACCC No data
Right 1186066919 X:5776257-5776279 TCCCCACAACTGAGACAACCAGG No data
1186066914_1186066923 27 Left 1186066914 X:5776223-5776245 CCCAACATACAAGGGGTATACCC No data
Right 1186066923 X:5776273-5776295 AACCAGGAAGTTGCTGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186066914 Original CRISPR GGGTATACCCCTTGTATGTT GGG (reversed) Intergenic
No off target data available for this crispr