ID: 1186067280

View in Genome Browser
Species Human (GRCh38)
Location X:5779346-5779368
Sequence CTAAGTCTACACCTGGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186067275_1186067280 -1 Left 1186067275 X:5779324-5779346 CCTCCACAGCTGTACCTTGGTTC No data
Right 1186067280 X:5779346-5779368 CTAAGTCTACACCTGGGTGTTGG No data
1186067276_1186067280 -4 Left 1186067276 X:5779327-5779349 CCACAGCTGTACCTTGGTTCTAA No data
Right 1186067280 X:5779346-5779368 CTAAGTCTACACCTGGGTGTTGG No data
1186067273_1186067280 15 Left 1186067273 X:5779308-5779330 CCTTTCTTCACTGAATCCTCCAC No data
Right 1186067280 X:5779346-5779368 CTAAGTCTACACCTGGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186067280 Original CRISPR CTAAGTCTACACCTGGGTGT TGG Intergenic