ID: 1186069909

View in Genome Browser
Species Human (GRCh38)
Location X:5808429-5808451
Sequence GACTCACAGCTCCCCATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186069905_1186069909 16 Left 1186069905 X:5808390-5808412 CCTGAGACTGGGTAATTTATGAA 0: 841
1: 7808
2: 13495
3: 13860
4: 10489
Right 1186069909 X:5808429-5808451 GACTCACAGCTCCCCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186069909 Original CRISPR GACTCACAGCTCCCCATGGC TGG Intergenic
No off target data available for this crispr