ID: 1186072904

View in Genome Browser
Species Human (GRCh38)
Location X:5842106-5842128
Sequence AAGCAGAAGCAGAAACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 0, 2: 9, 3: 119, 4: 1024}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186072904 Original CRISPR AAGCAGAAGCAGAAACAGGA GGG Intronic
900765095 1:4499665-4499687 AAGCAGAATAAGATACAGTAAGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
901228873 1:7630962-7630984 AAGGATAAGCAAAAACAGAAGGG - Intronic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
901746065 1:11374565-11374587 AAGCAGGCGCTGAAACAGGCAGG - Intergenic
901765861 1:11499652-11499674 AAACAAAAGAAGAAACAGAAAGG - Intronic
901822735 1:11840514-11840536 AAGCAGAGGTAGAATCAGGCGGG + Exonic
902123102 1:14184509-14184531 GAGCGGAAGCAGCAGCAGGAGGG + Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903242442 1:21992436-21992458 AAGGTGAAGCAGGAACATGAAGG + Intronic
903245952 1:22015621-22015643 AAGGTGAAGCAGGAACATGAAGG + Intergenic
903274182 1:22210400-22210422 AGTCAGAAGCAGCAACAGAAGGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903437245 1:23359841-23359863 AAGCAGCAGCAGGAACTGGTTGG + Exonic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
903575907 1:24339631-24339653 GACCAGAAGGAGAATCAGGAAGG - Intronic
903680757 1:25095190-25095212 AGGCAGAAGGAACAACAGGAAGG + Intergenic
903753119 1:25642177-25642199 TAGCAGAGGCAGCCACAGGAGGG - Intronic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904634130 1:31866646-31866668 AAGGTGAAGTAGGAACAGGAAGG - Intergenic
904969346 1:34406759-34406781 AAGCAGAACAATAAACAGGAAGG - Intergenic
905479103 1:38248973-38248995 AAGCAGAAACAGAAACAAAATGG - Intergenic
905521321 1:38602862-38602884 AAACAGGAGCAGAAACAGAAAGG + Intergenic
905751483 1:40468406-40468428 AAGAAGAAAAAGAAACTGGATGG + Intergenic
905799140 1:40832278-40832300 CAGCACAGGCAGAAACAGCATGG - Intronic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906569541 1:46824982-46825004 AAGCAGAAGCAGCCATGGGAAGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906835252 1:49076414-49076436 ATGCAGAACCAGAGACAGGGAGG + Intronic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907705530 1:56829158-56829180 GAGGAGAAGGAGACACAGGAAGG - Intergenic
908033681 1:60029258-60029280 AAGCCAAGGCAGTAACAGGAGGG - Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908126608 1:61037762-61037784 AATCAGTAGCAAAAACAGAATGG - Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908958545 1:69666955-69666977 AAGCAAAAGCAGTACCAAGAAGG - Intronic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909177740 1:72381485-72381507 AAGCAGAAGCTGGAACAGTTTGG - Intergenic
909297533 1:73969816-73969838 AAGATGAAGCAGGAACATGAAGG + Intergenic
909331582 1:74418940-74418962 CAGCAACAGCAGAAACAAGAAGG - Intronic
909475627 1:76077786-76077808 GAGAAAAAGCAGATACAGGAAGG - Intronic
909647048 1:77929434-77929456 AAGCAGAAGAAGAAGCCAGAAGG + Exonic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910564504 1:88628119-88628141 AAAAAGAAGAAGAAAAAGGAAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911054423 1:93698121-93698143 AGGCAGCAGCGGAAGCAGGATGG + Intronic
911406355 1:97445283-97445305 AAGGTGAAGCAGAGACATGAAGG - Intronic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911778054 1:101840341-101840363 AAACAGACTCAGAGACAGGAAGG + Intronic
911791799 1:102026539-102026561 AAAAAGAAGCAGCACCAGGATGG - Intergenic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912169159 1:107076967-107076989 AGGCAAAAGCAGAAACTGCAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912379180 1:109237790-109237812 AAGCAGAAGAAGCAACATGAGGG + Exonic
912658615 1:111509107-111509129 AAACAAAAGCAGCACCAGGATGG + Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913309426 1:117473394-117473416 GGGCAGAGGCAGAAACAGAAAGG - Intronic
913332372 1:117678194-117678216 AAGCTGAATCATAAATAGGAGGG + Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
913483653 1:119314257-119314279 CAGCATAAGCAAAAACATGAAGG + Intergenic
913610324 1:120504343-120504365 AAATAGAGCCAGAAACAGGAAGG + Intergenic
913691185 1:121281407-121281429 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
913984474 1:143552491-143552513 AAATAGAGCCAGAAACAGGAAGG - Intergenic
914580867 1:149017896-149017918 AAATAGAGCCAGAAACAGGAAGG - Intronic
914753905 1:150552545-150552567 AAGCAGCAGCAGATACAGCCAGG - Exonic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915705371 1:157838783-157838805 AAGCAGAAGGGGAGACTGGAAGG + Intronic
915745217 1:158150938-158150960 GAGCAGAAGCACACACAGAAAGG - Intergenic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916853221 1:168725179-168725201 AAGCAAAGGAAGAAAAAGGAAGG - Intronic
917143521 1:171862806-171862828 AAAGAGAAGCAGCAACAGAAGGG + Intronic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917562624 1:176175232-176175254 CCGCAAAAGCAGAAACAGTAGGG + Intronic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
917641757 1:176989853-176989875 GAGCACAAGCAGAAACAGTTGGG - Intronic
917813910 1:178688201-178688223 AAGCTAAAGCAGAAACAGAAGGG - Intergenic
917963573 1:180164906-180164928 AAGCAGGAGAGGAAGCAGGAGGG + Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918912604 1:190592847-190592869 GAGCAGAGGTAGAAGCAGGAGGG - Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919906296 1:202080749-202080771 AAGCAGAAGAAAGAAAAGGATGG + Intergenic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920478509 1:206299883-206299905 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921523392 1:216186282-216186304 AAGCAGAAGCTGGAACATGAAGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
922402712 1:225276928-225276950 AATAAGAAGAAGAAAAAGGAAGG + Intronic
922911193 1:229218845-229218867 AAGCAGCACCCGAAACAGCAAGG + Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923483402 1:234405811-234405833 AAGGAGAAGCTGACACAGTATGG + Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924593568 1:245426227-245426249 GAGCAGATGGAAAAACAGGAAGG - Intronic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924805142 1:247355946-247355968 GAAGAGAAGCAGAAACAGAAAGG + Intergenic
1062765352 10:58608-58630 AAGCAGGAGCAGAAAACAGAGGG + Intergenic
1062993354 10:1841510-1841532 GAGCAGAAGCAGCCACAGAAAGG + Intergenic
1063114429 10:3063966-3063988 ATGCACAGGCAGAAACAGCAGGG + Intergenic
1063182912 10:3622115-3622137 AAGCAGAAGCAAATACAGGCAGG + Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063287009 10:4700606-4700628 AACCAGAAGCATAAGCAGTATGG + Intergenic
1063362473 10:5469535-5469557 AGTCAGAAGCAAACACAGGAAGG + Intergenic
1063917197 10:10895459-10895481 AAGCAGAAGCAGAAAAAATATGG + Intergenic
1063939644 10:11114091-11114113 AAGCAGAGGGAGAAATAGGGAGG - Intronic
1063962643 10:11319590-11319612 AAACAAAAGCAGACACAGCAGGG + Intronic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1064949018 10:20825917-20825939 AAGCAGAAGGTAAAACAGGCTGG + Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065066148 10:21966991-21967013 AAGAAGAAGAAGAAAAAGGTGGG - Intronic
1065362125 10:24898589-24898611 GAGGAGAAGCAGAGACAAGAAGG - Intronic
1065375799 10:25040130-25040152 AAGCAGAAGCAGAAGCTACAAGG + Intronic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067293074 10:44958657-44958679 AAGCAAACGCAGAAACGGGAGGG + Intergenic
1067655093 10:48185885-48185907 GAGCAGAGGCAAGAACAGGATGG + Intronic
1067920183 10:50447598-50447620 AAAAAGAAGCAGAAACAATATGG - Intronic
1068279380 10:54849262-54849284 AAGCAGAAGAAGACACAGAAAGG - Intronic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068395816 10:56459869-56459891 AAGCAGAACCAGAAACAATGTGG + Intergenic
1068605561 10:59001243-59001265 AATCTGAACCAGAAACAGTATGG + Intergenic
1068732199 10:60371869-60371891 AAGCAGAAACATAAATAGAAGGG + Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069086706 10:64148816-64148838 AAGCTGAGACAAAAACAGGAGGG - Intergenic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071191424 10:83105882-83105904 AAGAAGAAGAAGGAAAAGGAAGG - Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1072504618 10:96052749-96052771 AGGCATCAGCAGAAAAAGGAGGG - Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073499806 10:103926225-103926247 AAGCAGAAGCAGATATAAAAGGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074708490 10:116157530-116157552 CAGCATATGCAGAAACATGAAGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075050248 10:119178280-119178302 AAACAGCAGCAGAAACACGCGGG + Intronic
1075908903 10:126106466-126106488 AAGAAGAAGAAGAAAAAGAAGGG - Intronic
1076105985 10:127824117-127824139 AAGCAGAGGGAGAAGCAGCATGG + Intergenic
1076210745 10:128642722-128642744 AGGCAGAAGGAGATACAAGAGGG + Intergenic
1076293220 10:129363659-129363681 AAACAGAAGCAGAACCAGTCAGG - Intergenic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1076597248 10:131631718-131631740 AAGCAGAAGGAAAACCAGGAAGG - Intergenic
1076656123 10:132024796-132024818 AAACAGGAGAAGAAATAGGAGGG - Intergenic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077402004 11:2363554-2363576 ATGCAGACGCACACACAGGAAGG - Intergenic
1077534207 11:3112155-3112177 AAACAAAAACAGAAACATGAAGG - Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078391447 11:10938671-10938693 AAGCAGAAGAGGAAAAAGAAGGG - Intergenic
1078415690 11:11162807-11162829 TAGTAGAAGCAGCAACAAGAGGG - Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079956046 11:26866051-26866073 AAACAAAAACAGAAAAAGGAAGG + Intergenic
1079980942 11:27150869-27150891 AGGCAGAAGCTGAAACAGTTTGG - Intergenic
1080083590 11:28251903-28251925 TAGCAGAGGAAGAAAAAGGAAGG - Intronic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080364251 11:31552667-31552689 AAGCAAAGGTAGAAACAGGGAGG - Intronic
1080601242 11:33822195-33822217 GAGCAGAAACAGAAATGGGAAGG - Intergenic
1080660299 11:34290720-34290742 AACCAGAGGCAGAAACACCATGG + Intronic
1081057709 11:38431189-38431211 AAGCAGACAGAGGAACAGGAAGG + Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081584206 11:44373009-44373031 AAGCAGATGGAGCAACAAGATGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082234540 11:49807781-49807803 AAGCAGATGCAAAAACAAAAAGG - Intergenic
1082672422 11:56051863-56051885 AGGCAAGAGCAGAAACAGGGAGG - Intergenic
1082741445 11:56916037-56916059 TAGAAGAACCAGAACCAGGATGG - Intergenic
1083443223 11:62690456-62690478 AAGCAGGAGCAGGAGCAGGCAGG + Exonic
1084508176 11:69583858-69583880 AAACAGAAGCAGAACAAAGAAGG - Intergenic
1084971140 11:72772722-72772744 AAGAAGAGGCAGAACCAGGGTGG - Intronic
1085107820 11:73861289-73861311 AAGCAGGAGGAGAATCATGAAGG - Intronic
1085401032 11:76235597-76235619 AAGGAGATGCGGAAAAAGGAAGG - Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086147346 11:83567084-83567106 AAACAGAGACATAAACAGGAAGG + Intronic
1086345550 11:85892136-85892158 AAGCAGAGCCAGACACAGCAGGG + Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087126726 11:94635205-94635227 AAGAAGCAGCAGACACAGCATGG - Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087955604 11:104283284-104283306 AAGCAGAAGAATAAACATGGAGG - Intergenic
1088139120 11:106594488-106594510 AAGCAGAAGAAGAAAAATGCAGG - Intergenic
1088751579 11:112846600-112846622 AAGCAGAAGCTGGAACATCAAGG - Intergenic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089148097 11:116345086-116345108 AAAAAGAAGCAAAGACAGGAAGG + Intergenic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1089605847 11:119640776-119640798 CAGCAGAAGGAGGAACTGGAAGG - Intronic
1090095471 11:123738489-123738511 AACCTGAAGCAGGAAAAGGAGGG + Intronic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1090345684 11:126068339-126068361 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1090692482 11:129198810-129198832 AAGCAGAGGCTGAAACAGTTTGG + Intronic
1091034239 11:132218739-132218761 AAGCAGAAGAACGAACAAGATGG - Intronic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091638300 12:2214848-2214870 AAGCAGAAGCATAGACTAGAAGG - Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093100340 12:15020656-15020678 AAGCAAATGGAGAAACAGAACGG + Intergenic
1093117753 12:15232993-15233015 AAGTAGAAGCAAAAACTGGTAGG + Intronic
1093232220 12:16559965-16559987 AAGCAAAAACAAAAACATGAGGG + Intronic
1093250528 12:16798017-16798039 TAGCAAACCCAGAAACAGGAAGG - Intergenic
1094303431 12:28991791-28991813 AAGGCCCAGCAGAAACAGGAGGG - Intergenic
1094447758 12:30550213-30550235 AAGCAGGAGGAGGAAGAGGAGGG - Intergenic
1094498127 12:31001984-31002006 AAGAACAAGCAGAGACAGGGTGG + Intergenic
1094686927 12:32726711-32726733 AAGCAGCAGCAGAAACACTAGGG - Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096544715 12:52329766-52329788 AAGCAGAAGCTTGCACAGGATGG - Intergenic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096715189 12:53486946-53486968 GAGCACAAGCAGCAGCAGGAAGG - Exonic
1097231506 12:57514680-57514702 AAGCAGAAGTGGAAAAAAGAGGG - Intronic
1097332460 12:58346567-58346589 AAGCTGAACCAGAAATAGAAAGG - Intergenic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1098196615 12:68008720-68008742 AAGTAGAAGGGGAAACAGCATGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098895304 12:76053279-76053301 AAGAAGAAGCAGAAACACAAGGG - Exonic
1099109220 12:78536295-78536317 AAGCAGAATGAGAACCAGCAGGG + Intergenic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099312351 12:81042847-81042869 AAGCTGTTGGAGAAACAGGACGG - Intronic
1099935775 12:89123447-89123469 AAGCAGAGACAGAAAAAGTAAGG + Intergenic
1099986389 12:89670201-89670223 GACAAGAACCAGAAACAGGAGGG + Intronic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1101141141 12:101797317-101797339 AGACACAAGCAGAAACAGAAGGG + Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104143387 12:126009370-126009392 AACCAGGAGCTGAAGCAGGAGGG + Intergenic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104316190 12:127704214-127704236 AAGAAGCAGAAGAAACAAGAAGG + Intergenic
1104620449 12:130307996-130308018 GAGCAGGAGCAGAGACAGGTCGG + Intergenic
1104681435 12:130754717-130754739 AAGCAGGAGCAGAAACTAAAGGG + Intergenic
1105617859 13:22036829-22036851 AAGCAGAAAAAAAAAAAGGATGG - Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106195622 13:27491718-27491740 AGGAAGAGGAAGAAACAGGAGGG + Intergenic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1106466636 13:30019737-30019759 AATCAGGAGCAGACACAGGCAGG + Intergenic
1106578618 13:30999072-30999094 AACAAGAGCCAGAAACAGGAAGG + Intergenic
1106816224 13:33410303-33410325 AAGCAGAAGCAGAAAAATGTAGG + Intergenic
1107026796 13:35810017-35810039 AAGCAGAAGGAATAACAGGGTGG - Intronic
1107066723 13:36221443-36221465 AAGAAAAAGCACAAACAAGAAGG + Intronic
1107677161 13:42809355-42809377 AAGCAGAACCAGTGACAGCAGGG - Intergenic
1108170184 13:47733440-47733462 AAGTAGAAATAGAAACAGAATGG + Intergenic
1108173121 13:47764269-47764291 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1108256205 13:48613375-48613397 AGGAAGAGTCAGAAACAGGAGGG + Intergenic
1108305593 13:49128883-49128905 AAGCTTAAGCAGAAACTTGAAGG - Intronic
1108647334 13:52443430-52443452 AAGAAGAGGAAGAGACAGGAGGG + Intronic
1109505121 13:63290183-63290205 AAGGAAAAGCAGAAAAAGTAAGG + Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110180183 13:72607390-72607412 AATCCGAAGCAGAGAAAGGATGG + Intergenic
1110502643 13:76246725-76246747 AAGAAGAAGAAGAAAAAGAAGGG - Intergenic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1111351493 13:87036878-87036900 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1111393873 13:87636996-87637018 AATAAGAAGAAAAAACAGGATGG + Intergenic
1111527714 13:89493234-89493256 AAGCAGAGGCTGAAACAGTTTGG - Intergenic
1111904709 13:94241641-94241663 AAGCTAAAACAGAAAAAGGAGGG + Intronic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112215412 13:97425876-97425898 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1112254047 13:97812373-97812395 AAGCACAATCAGAAACAACAAGG + Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112496759 13:99911400-99911422 AATCAGAGGGAGAAACAGGGAGG - Intergenic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113053056 13:106236262-106236284 AAGAAGAAGAAGAAAAAGAAAGG - Intergenic
1113222025 13:108115870-108115892 AACCAGAAGCAGAGATAAGATGG + Intergenic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1114254401 14:20989316-20989338 ACGTAGCAGCAGACACAGGAGGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115368800 14:32588971-32588993 GAGCAGAGGTAGAGACAGGAAGG - Intronic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1116135992 14:40924368-40924390 AACCGGGAACAGAAACAGGATGG + Intergenic
1116162058 14:41280504-41280526 AAGTAGAAGTAGAAACAGAGTGG + Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116507681 14:45704876-45704898 AAGCAGAGGAAGACACAAGAGGG - Intergenic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117289429 14:54318317-54318339 AAGCTGACGCAGAAGCAGAAGGG + Intergenic
1117313159 14:54548493-54548515 AAACAGAGGCAAAATCAGGAAGG - Intergenic
1117396726 14:55317983-55318005 AAGTAGAAGATAAAACAGGAGGG - Intronic
1118019495 14:61695947-61695969 GAGCAGCAGCAGAAACAAAAAGG - Intronic
1118062878 14:62160174-62160196 AGGCAGGAGCAGAACCAGGGAGG - Intergenic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119904975 14:78293469-78293491 AAACAGTAACAGAAATAGGAAGG - Intronic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120782776 14:88500883-88500905 AAGCAGAAGAAGAAACACCCAGG + Intronic
1121242858 14:92442554-92442576 AAGCAGTGGCAGAACCAGGGAGG - Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122777902 14:104130876-104130898 GAGAAGAGGCAGGAACAGGAGGG + Intergenic
1123155058 14:106216825-106216847 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1123181574 14:106476236-106476258 TAGCAGAAGCAGAAACACAAAGG - Intergenic
1123206509 14:106718876-106718898 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1202945330 14_KI270726v1_random:20493-20515 TAGCAGAAGCAGAAACACAAAGG + Intergenic
1123401720 15:19993967-19993989 TAGCAGAAGCAGAGACACAAAGG - Intergenic
1123503148 15:20910364-20910386 AAGCATACCCAGAAACATGAAGG - Intergenic
1123511063 15:21000628-21000650 TAGCAGAAGCAGAGACACAAAGG - Intergenic
1123560396 15:21484029-21484051 AAGCATACCCAGAAACATGAAGG - Intergenic
1123596635 15:21921330-21921352 AAGCATACCCAGAAACATGAAGG - Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1123744695 15:23310817-23310839 CAGCTGAAGCAACAACAGGATGG - Intergenic
1123901921 15:24885959-24885981 ATGCAGAAACAGAAACCAGACGG - Intronic
1124270097 15:28272350-28272372 CAGCTGAAGCAACAACAGGATGG + Exonic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1124583106 15:30979618-30979640 AAGCAGAAGTAATAACAGGAAGG + Intronic
1124902277 15:33835485-33835507 AAGGAGAGGCAGAGACAGGGAGG - Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126878861 15:53072947-53072969 AAGCAGAGGCAGAAACAGCATGG + Intergenic
1127122100 15:55780570-55780592 AAGCAGAAGAAGAAGAAGAAAGG + Intergenic
1127347653 15:58116632-58116654 AATCAGTAGCAGAACAAGGAGGG + Intronic
1127543528 15:59967149-59967171 AGGCTGAAACAGAAACAGCAGGG - Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128498145 15:68209935-68209957 GGACAGAAACAGAAACAGGAAGG + Intronic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128830594 15:70764404-70764426 AAGAGGATGAAGAAACAGGAAGG + Intergenic
1129190390 15:73934050-73934072 AAGCAGGAAGAGACACAGGATGG + Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130794422 15:87193794-87193816 AATGAGAAGAGGAAACAGGAAGG - Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131348119 15:91670402-91670424 GAGCAGAAGAAATAACAGGAAGG - Intergenic
1131414854 15:92245849-92245871 AAGCAGAAGCAGATCCTGCAGGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1202968744 15_KI270727v1_random:211193-211215 AAGCATACCCAGAAACATGAAGG - Intergenic
1132510730 16:340022-340044 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1132863583 16:2083130-2083152 AAGTAGAAGCAGCAACAGAGGGG - Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133532927 16:6672674-6672696 AAGCAGAAGCGGAATCATGGTGG - Intronic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1134514286 16:14874144-14874166 AAGCAATGGCGGAAACAGGAAGG - Intronic
1134701961 16:16272792-16272814 AAGCAATGGCGGAAACAGGAAGG - Intronic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134969870 16:18521858-18521880 AAGCAATGGCGGAAACAGGAAGG + Intronic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135078486 16:19414093-19414115 GAGCAGACGCTGGAACAGGAAGG - Intronic
1135197042 16:20403208-20403230 AAGCAGAGGCAGGATCAGTAAGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1136240078 16:28938157-28938179 AAGAAAAAGAAGAAACTGGAGGG - Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136705095 16:32180720-32180742 CAGCTGAAGCAACAACAGGATGG + Intergenic
1136762817 16:32748685-32748707 CAGCTGAAGCAACAACAGGATGG - Intergenic
1136805283 16:33121701-33121723 CAGCTGAAGCAACAACAGGATGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137960358 16:52876423-52876445 CACCAGAAGCAGAAAAATGAGGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1138297693 16:55900932-55900954 AAACTGAAGCACAAAGAGGAAGG + Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141274549 16:82574817-82574839 CAGCAGAAGCAGAAATCAGAGGG - Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141424118 16:83934500-83934522 AAGCCGAGGCCGAGACAGGAGGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1203064973 16_KI270728v1_random:1009005-1009027 CAGCTGAAGCAACAACAGGATGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143178279 17:4968784-4968806 AAGCAGAACCAGGAGCTGGAAGG - Exonic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143869468 17:9947897-9947919 AAGCAGGAGGAGGAAGAGGAGGG - Intronic
1144001127 17:11056176-11056198 AAAGAGAAGGAGAAACAGAAAGG - Intergenic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144654125 17:17024774-17024796 AAGCACAGGCAGAAACTGTAGGG + Intergenic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1145992826 17:29089497-29089519 AAAAAAAAGCAGAGACAGGAGGG + Intronic
1146495111 17:33314858-33314880 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1146834952 17:36103379-36103401 CAGCAGAAGAAGGCACAGGAAGG + Intergenic
1146849562 17:36210614-36210636 CAGCAGAAGAAGGCACAGGAAGG + Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147663485 17:42130087-42130109 AAGAAGGGGCAGAAACAGGATGG + Intronic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1149893110 17:60407799-60407821 AAAAAAAAGCAGAAACAGGCCGG + Intronic
1150054982 17:62006308-62006330 AAGGAGAAGGGGAGACAGGAAGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151318853 17:73340533-73340555 AAGCAGAAGCTGGACCAAGATGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152664790 17:81561287-81561309 AAGCAGAAGAAGAAGCTGGGCGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153286664 18:3462347-3462369 AACCAAAAGCATAAACTGGAGGG - Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153572873 18:6491102-6491124 AAGAAGGAGGAGGAACAGGAAGG - Intergenic
1153645609 18:7193401-7193423 AAGAAAAAAAAGAAACAGGATGG - Intergenic
1153860619 18:9201034-9201056 AATCAGATGCAGAAACAAAAAGG - Intronic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1154155037 18:11937347-11937369 AAGAAGAAGAAGAAACAAAAGGG + Intergenic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155384212 18:25259572-25259594 AAACAAAAACAGCAACAGGAGGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155417476 18:25614488-25614510 AAGGAAAAGTAGAAAAAGGAGGG + Intergenic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1155931923 18:31717618-31717640 AAGCAGAATCCAAAACAGAATGG + Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156110852 18:33725424-33725446 AAGCAAAAGTAGAAAGAGGTAGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156315458 18:35965129-35965151 AAGGAGAAGGAGAAAAAAGAAGG - Intergenic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1156666810 18:39418544-39418566 AAGCAGAAGAAGAAAAAGAAGGG + Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1156685585 18:39641634-39641656 AAGTACAAGGAGTAACAGGACGG + Intergenic
1156839608 18:41595644-41595666 AAGTAGAATCATCAACAGGATGG - Intergenic
1156867564 18:41905759-41905781 AAGAAAAATCAGAAACAGAAAGG - Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157394702 18:47331860-47331882 AAGCAGACTCAGAAGCTGGAAGG - Intergenic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157930958 18:51822825-51822847 AAGAAGAGGCAGGGACAGGAAGG - Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158613561 18:58965540-58965562 AAGCAGAAGTAAAAACTGGATGG - Intronic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159593582 18:70361030-70361052 AAGGTGAAGCAGGTACAGGAAGG + Intergenic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159801388 18:72904523-72904545 AAGATGAGGCAGAGACAGGAGGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159960410 18:74551141-74551163 AAGGTGAAGCAGGAACAGGCAGG - Intronic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160268455 18:77361792-77361814 AAGCACGAGCAGAAACACCAAGG + Intergenic
1160393933 18:78558524-78558546 AAGACGAAGCAGCTACAGGAGGG - Intergenic
1160411896 18:78680835-78680857 AAGCAGGTGCAGAGACAGTAAGG + Intergenic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161899234 19:7105449-7105471 AAGTAGAGGTAGAAACAGAATGG + Intergenic
1162011026 19:7815253-7815275 AAGAAGAATAAGGAACAGGATGG - Intergenic
1162670519 19:12253672-12253694 AGGCAGAAAAAAAAACAGGAAGG + Intronic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1163648320 19:18502787-18502809 TCTCAGAAGCAAAAACAGGAAGG - Intronic
1163717211 19:18879506-18879528 GAGCAGTAGTAGAAACAGGTGGG - Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164934675 19:32201559-32201581 AAGCAAAAGGAGAATCAGCAGGG + Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166482095 19:43183103-43183125 AAGCAGAGGCAGAGACACCATGG + Intronic
1166491835 19:43267081-43267103 CCCCAGAAGCAGAAACAGAAGGG - Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1167143368 19:47667446-47667468 CAGCAGAATTAGAGACAGGAGGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168381868 19:55930906-55930928 AACCAGAAGCTTAAACAGCATGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925882113 2:8361636-8361658 AAGCAGAGGGTGAAACATGAGGG - Intergenic
926053772 2:9761709-9761731 AAGCAGAGGCAGGAAAGGGAGGG - Intergenic
926726844 2:16005174-16005196 AAGGAGAAGGAGAAACAAGTCGG - Intergenic
926923162 2:17959449-17959471 AAGAAGAAGAAGAAAAAGAATGG - Intronic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
927195146 2:20541775-20541797 AAGCAGAGGCACAAACAGATGGG + Intergenic
927205584 2:20608276-20608298 TAGAAGTAGCAGAAACAGGCCGG + Intronic
927332781 2:21885651-21885673 AAGGAGATGCAGTGACAGGAAGG - Intergenic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927502430 2:23591611-23591633 GAGCAGACGCAGTGACAGGATGG - Intronic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928415584 2:31088934-31088956 CAGCAGATGCAGATACAAGAAGG + Intronic
928438070 2:31268780-31268802 AAGCTGAAGGAGAAATGGGAAGG + Exonic
928594748 2:32849082-32849104 AAACAAAAACAAAAACAGGATGG - Intergenic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929772718 2:44905987-44906009 AAGAAGAGGCAGAAAAATGAAGG - Intergenic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930190314 2:48452211-48452233 AAACACAACCAGCAACAGGAGGG - Intronic
930235567 2:48885646-48885668 AAGGAGAGGCTGATACAGGAAGG + Intergenic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931028697 2:58145181-58145203 AAGTAGACTCAGAAACAGAAGGG - Intronic
931418834 2:62106798-62106820 AAGCAGAAGCAGAGACTGTGTGG + Intronic
931469538 2:62524587-62524609 AAACAGAAGCAGATACTTGAAGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
932215723 2:69964725-69964747 AAGCAGGACAATAAACAGGAAGG + Intergenic
932489131 2:72107877-72107899 ATTCAGAAAAAGAAACAGGAAGG - Intergenic
932498313 2:72158619-72158641 ACGCAGAAACAGGGACAGGAAGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
933035698 2:77394773-77394795 AAGGTGAAGCAGGAACACGAAGG + Intronic
933085008 2:78045244-78045266 AAGCAGAAGCTGGAACAGTTTGG + Intergenic
933204725 2:79493201-79493223 AAGTAGAAAGAAAAACAGGAGGG + Intronic
933701018 2:85255589-85255611 AAGGAGAAGCCTAAACAGGGTGG + Intronic
933769673 2:85735041-85735063 AAGGAGAAGAGGGAACAGGAAGG + Intergenic
933896818 2:86818651-86818673 AAGGAGAAGGAGATACAGAATGG - Intronic
934631584 2:95930924-95930946 AAGCAGAAGCAGAAGTTAGAAGG - Intronic
934802063 2:97173761-97173783 AAGCAGAAGCAGAAGTTAGAAGG + Intronic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935109312 2:100077320-100077342 AAGCAAAAGAAGGAGCAGGAAGG + Intronic
935787898 2:106565722-106565744 AACCAGAAGTACAACCAGGAAGG - Intergenic
935818437 2:106869570-106869592 GAGCAAAAGCAGCAGCAGGAGGG - Intronic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936346778 2:111681530-111681552 GAGCAGATGGAGAAATAGGAAGG - Intergenic
936696066 2:114949697-114949719 AAACAGAAGCAACAACAGCAGGG - Intronic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
937169583 2:119852196-119852218 AAGGAGAAGCGGAAAAAAGAAGG - Intronic
937285258 2:120746524-120746546 AAACAGAAGCAGAAGAAAGAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
937884464 2:126890376-126890398 CAGCAGAGACAGAAACAGCAGGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938820614 2:134954736-134954758 AAGCAGTGGCAGCAACAGCAGGG - Exonic
938926482 2:136047850-136047872 AAGCAGATGGAGAAAGAGGTGGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939575567 2:143891014-143891036 AAGCAGACACAGAACCAGAATGG - Intergenic
939669060 2:144987219-144987241 AAGCAGAAACATCAGCAGGATGG - Intergenic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
939861543 2:147426950-147426972 AAAGAGGAGTAGAAACAGGAAGG + Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940274785 2:151927947-151927969 AGGCAGCAGCAGAAACTGAAAGG + Intronic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
941182227 2:162273372-162273394 AAGAAAATGCAGAAACAGCAGGG + Intronic
941938628 2:171009228-171009250 AGTCAGAAGCAGAAACGAGAAGG + Intronic
941998760 2:171626362-171626384 CAGCAGGAGCTGAAACAGGCAGG + Intergenic
942305239 2:174600764-174600786 AAGCAACAGCAGAAACAAGATGG - Intronic
942412452 2:175725192-175725214 AACAAAAAGAAGAAACAGGAAGG + Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
943171928 2:184412749-184412771 AAGCAAAAACAGAAAAAAGAGGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943778120 2:191790188-191790210 AAACATAAGCAGAAAGAGCAAGG - Intergenic
943848907 2:192690488-192690510 AGGCAGATGCAGAAATAGAATGG - Intergenic
943856197 2:192795500-192795522 AAGCAGAATCAGAAACACAAGGG - Intergenic
943958168 2:194220834-194220856 TAGCAGAAAAAGAAACAGGAGGG - Intergenic
944006948 2:194921111-194921133 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
944980585 2:205115224-205115246 AATCAGAACCAGGAAAAGGAAGG - Intronic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
946149709 2:217756066-217756088 ATGCAGAGGCAGAAAAATGAGGG - Exonic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
947204580 2:227648553-227648575 AAGCAGCAGCAGCACCAGGTAGG + Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948301357 2:236909570-236909592 AATCAGAAGCCGAGACTGGAGGG - Intergenic
948681686 2:239639479-239639501 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
948972945 2:241443434-241443456 AAGCAGAACCAGACACACCATGG + Intronic
1168956157 20:1835901-1835923 AAACAGAAGCAGAAACCAGAGGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169419580 20:5449145-5449167 AAGGAGAAGGGGAAACAGGGAGG - Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1170872245 20:20216980-20217002 AAGCAGAAACGTCAACAGGAAGG - Intronic
1170984004 20:21241856-21241878 AAGCTGAAGCAGAAAAAAAAAGG - Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172532310 20:35640985-35641007 AAGCAGAGGCAGAAAAATGTTGG - Intronic
1172913502 20:38427435-38427457 ATGCAGGAGCAGAAACAGACAGG + Intergenic
1172971280 20:38874678-38874700 TGGCAGAAGAGGAAACAGGAAGG + Intronic
1173387351 20:42601009-42601031 ATGCAGAATCATAAACAGAAAGG - Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173931707 20:46826354-46826376 AAGCAGAAGAACAAACAGGAGGG + Intergenic
1174452666 20:50629527-50629549 AAGCCGGAGGAGACACAGGACGG + Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174913667 20:54633172-54633194 AAGCAGAAGCATTACCTGGAGGG - Intronic
1175327404 20:58139362-58139384 AAGCAGATGAGGAAACAAGATGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175502841 20:59462421-59462443 AAGCTGAGGCATGAACAGGAGGG + Intergenic
1176170391 20:63693944-63693966 AAACAGAGGCAGAAACAGGGAGG - Intronic
1176521153 21:7825560-7825582 AGGCAGAAGCAGAAACGGCCAGG - Exonic
1177921089 21:27153507-27153529 AAGCAAGATCACAAACAGGATGG - Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178394285 21:32227174-32227196 AACCCAAAGCAGAAAAAGGAAGG + Intergenic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178655173 21:34455572-34455594 AGGCAGAAGCAGAAACGGCCAGG - Intergenic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179552971 21:42154964-42154986 AATCAGAGCCAGACACAGGAGGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179645975 21:42776430-42776452 AAACAAAAGCAGAAACAAGAAGG - Intergenic
1180013596 21:45068288-45068310 AATCAGATGCAAAAACAGTATGG - Intergenic
1180222337 21:46367026-46367048 AAACTGAAGCGGAAACACGAAGG + Exonic
1180607715 22:17072701-17072723 CAGCAGAAGCAGTAACAAGAGGG - Intergenic
1181076843 22:20384457-20384479 AAGCAAAAATAGAAACAGGATGG - Intronic
1181323624 22:22027798-22027820 CAGAAGTAGCAGAAACAGGGTGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181931720 22:26407154-26407176 AAACAAAAACAGAAACAAGATGG + Intergenic
1182076591 22:27499361-27499383 CAGCAGCAGCTCAAACAGGACGG + Intergenic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1182715094 22:32351935-32351957 AAGCAGAAGAAAAACCAGGCTGG + Intergenic
1182909128 22:33965932-33965954 AAATAGTAGCAGAGACAGGAAGG - Intergenic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183379677 22:37484664-37484686 ACACAGACGCATAAACAGGAAGG + Intronic
1183688771 22:39376522-39376544 AAGCAGAGGCCTAGACAGGAAGG + Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184418675 22:44366717-44366739 AAGCTGGAGGAGAAATAGGATGG - Intergenic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185035534 22:48474779-48474801 AAGGAAAAGCAGAAAAAGCAGGG + Intergenic
949142860 3:655892-655914 AAGCAGAAGAAGCAAAAGGAAGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
950346733 3:12302242-12302264 ATACAGAAGAAGAAACAAGAAGG + Intronic
950575931 3:13832069-13832091 AAGCAGGAGCAGGAACAGGAGGG - Intronic
950918609 3:16670099-16670121 AAGCAGAAGAAGAAAAAGAAGGG + Intronic
950996419 3:17502404-17502426 AAGTAGAAGGAAAACCAGGATGG - Intronic
952188964 3:31001800-31001822 CAGCAGAAGCAGGAACAACAGGG + Intergenic
952222588 3:31340115-31340137 AAGCAGAATGAGGTACAGGAAGG + Intergenic
952278044 3:31896668-31896690 AAGCAGAAGCACCAGCTGGAAGG + Intronic
952480596 3:33757330-33757352 AAGCAAAAGCAAAAAAAGGGTGG - Intergenic
952975138 3:38687582-38687604 AATCAGAATCAGAAACTGGGTGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953227214 3:41031591-41031613 AAGCAGAAGCACCAACTGGCTGG + Intergenic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954245370 3:49327239-49327261 AAAGAGAACCAGAAACAGGCTGG + Intronic
954333565 3:49903559-49903581 CAACAGCAGCAGCAACAGGAAGG + Exonic
954715410 3:52524372-52524394 AAGCAGAAGCATGCACAGGGAGG + Exonic
954792765 3:53145313-53145335 AGGCAGAACCAGGAACTGGAGGG - Intergenic
954927482 3:54249077-54249099 AAGGAGAAGAATAAACAGCATGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955824955 3:62936019-62936041 AAGCAGAAGCAGAAACTCTCAGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG + Intergenic
956925843 3:73987407-73987429 AAGCAGAGTCACAAACAGAATGG + Intergenic
957070309 3:75562732-75562754 AGGCAGAACCAGGAAAAGGATGG + Intergenic
957120340 3:76082428-76082450 AATGAGAAGCAGGAACAAGAGGG + Intronic
957179884 3:76862718-76862740 AGAAAAAAGCAGAAACAGGAAGG - Intronic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957947061 3:87078465-87078487 TAACAGAAGCAGAAATGGGAAGG + Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958576243 3:95952497-95952519 GAGCAGATGCTGCAACAGGAGGG + Intergenic
958730141 3:97952531-97952553 AAGCTGAAGAAGGAACAGAAGGG + Intronic
958991625 3:100852616-100852638 CAGCAGGACCAGAAACAGCAGGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960409979 3:117311056-117311078 AAGCAGATGCAGAAACAGAGAGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960475965 3:118129040-118129062 AAGCAAATGCACAAACATGAAGG - Intergenic
960582809 3:119294923-119294945 AAGCAGAAGCTGAAACGAAAGGG + Exonic
960620753 3:119634750-119634772 GAGCAGAAGCAAAAACAAAAGGG - Intergenic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
960738499 3:120806392-120806414 AAGAAGCAGCAGAAACACAAGGG + Intergenic
961726546 3:128934513-128934535 AAACAAAAGCAAAAACAGGCCGG - Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961919068 3:130407186-130407208 TAGCATAAGCAAAAACATGAGGG + Intronic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962048356 3:131785390-131785412 AAAAATAAGCAGAAACATGAAGG - Intronic
962328280 3:134454275-134454297 AAGCAGCAACAGCAACAGCATGG - Intergenic
962967203 3:140366044-140366066 AAGGACAAGCTGACACAGGAGGG + Intronic
963129528 3:141845607-141845629 AAGCAGAAGCGCAGACAGCAGGG - Intergenic
963353163 3:144177336-144177358 AAGCAAAAACAGAAAAAGCAAGG - Intergenic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
964564315 3:158033109-158033131 AAGAAGAAGAAGAAAAAGAAGGG + Intergenic
964637029 3:158869415-158869437 AAGAAGAAGACGAAAAAGGAGGG - Intergenic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
966304775 3:178518928-178518950 GAGCAGAGGAAGACACAGGATGG - Intronic
966399174 3:179530550-179530572 AATCAGAAGCTTAAATAGGATGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966656772 3:182367291-182367313 AAACACAAAAAGAAACAGGATGG + Intergenic
966750048 3:183313324-183313346 TAGCAGAAGGAGACACTGGAGGG + Intronic
967631885 3:191753508-191753530 AAGCAGAAGCCAAAACAGGGAGG - Intergenic
967938173 3:194746019-194746041 AAACAGAAAGAGAAACTGGAAGG + Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968502668 4:958354-958376 GAGCAGGCGCAGCAACAGGAAGG - Exonic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969314806 4:6375435-6375457 AGGCAGAGGCAGAAAGAGAATGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969727189 4:8927306-8927328 TAGTAAAAGGAGAAACAGGAGGG - Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970023872 4:11600022-11600044 AAGCAGACGCAAGAACAAGATGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970534059 4:17011170-17011192 AAACTGAGGCAGAGACAGGAAGG + Intergenic
970816278 4:20159960-20159982 AAACAGAACCAGAACCAGTAGGG - Intergenic
970852632 4:20619302-20619324 AAGCAGAAGCACATGCACGAGGG + Exonic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971218788 4:24686282-24686304 AAGAAAAAGTAGTAACAGGAGGG + Intergenic
971233493 4:24819755-24819777 AAGCAGCAGCACAAAGGGGAAGG + Intronic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971408479 4:26344680-26344702 AAGCAGAAGAGAAAAAAGGAAGG + Intronic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971913629 4:32829255-32829277 AAACAAAAGCAAAAACATGAAGG + Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
973656502 4:53053648-53053670 AAGCGGATGCAGAAACATGGAGG - Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
973897923 4:55434714-55434736 AAACAAAAGGAAAAACAGGATGG + Exonic
974330975 4:60478760-60478782 AAGCAGAAGCAAGAAAAAGACGG + Intergenic
974685927 4:65229229-65229251 AGGAAGAAACAGAAACAGCAGGG - Intergenic
975480103 4:74868800-74868822 AGCCAGAAGCAGAAACATAAAGG + Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976335016 4:83875578-83875600 ATGCAGAATTAGATACAGGATGG - Intergenic
976904026 4:90213886-90213908 AAACAGAAGTAGAGACAGAAAGG + Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
978262131 4:106772922-106772944 ATGCAGAAGCTGAAACAGTGTGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978608322 4:110507480-110507502 AGGCAGAAACAGATACAGGGAGG - Intronic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978912290 4:114078414-114078436 AAGAAGAAGAAGAAACACAAAGG + Intergenic
979194211 4:117900576-117900598 ATACAGAAGCAGACACAGAAGGG - Intergenic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979717208 4:123854356-123854378 ATGCCGCAGTAGAAACAGGAAGG - Intergenic
980175055 4:129334462-129334484 AAGCAGAGGCCAAAAGAGGATGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980314717 4:131182951-131182973 AAGCAGAAGCATACACAAGAGGG - Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981072450 4:140558162-140558184 AAGGTGAAGCAGTAACACGAAGG - Intergenic
981075771 4:140589851-140589873 AAGAAGAAGGAGAAACAAAACGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981675421 4:147338157-147338179 AAGCAGAACCAGAGACATGCAGG + Intergenic
981856147 4:149295306-149295328 AAGAAGAAAGAGAAACACGAGGG + Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
982934760 4:161458641-161458663 AAGCAGAAACAGAAAGAAAATGG - Intronic
983165676 4:164474399-164474421 CAGCAGAAGCAGTACCAAGAGGG - Intergenic
983226384 4:165089732-165089754 AAGAAGGACAAGAAACAGGAGGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984006928 4:174323309-174323331 ACGCTGATGCAGAAACATGAGGG - Intronic
984055227 4:174920218-174920240 AAGCAGAAGTTGAAACTTGATGG + Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984381749 4:179001898-179001920 AAGCAGAAGAGGAAAAAGGTGGG - Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
985074395 4:186198686-186198708 AAGCAGAAGCAGAGACCAAATGG + Intronic
985105007 4:186491276-186491298 AAGTAGACGTAGACACAGGATGG - Intronic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986551773 5:8964181-8964203 AAACACAAGCAGAACCATGAGGG - Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986777303 5:11028291-11028313 TAGCAGCTGCAGAAACAGGAGGG - Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
987354666 5:17052762-17052784 AACCAGAAGAAGAAAGAAGAAGG - Intergenic
987979766 5:25067777-25067799 AGGCAGATGTACAAACAGGATGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988510910 5:31864048-31864070 AACCAGAAACAGAAAAAGCAAGG - Intronic
988555331 5:32231454-32231476 AAGCAGAAGTAAAAACATGTGGG + Intronic
988671130 5:33383086-33383108 AAGAAACAGCAGAAACAAGAAGG + Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
988995699 5:36713077-36713099 AAGCAGACACAGAAAAAGCATGG + Intergenic
989238509 5:39176908-39176930 AGGCAGGAGCAAAAACAGAAAGG + Intronic
989394860 5:40943172-40943194 AAGCCTAAGCTGAAACAGGAAGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
990845652 5:60135534-60135556 TACCAGAAGCAGTAACAGGAAGG + Intronic
990947524 5:61264407-61264429 AAACAGAACCCCAAACAGGAAGG + Intergenic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991365780 5:65866561-65866583 CAGCCAAAACAGAAACAGGAGGG + Intronic
991651725 5:68862459-68862481 AAACAGCAGTAGAAAGAGGATGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992107928 5:73465422-73465444 ATGCAGTAGCAGAAACAAGCTGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992271502 5:75068883-75068905 AAACATCAGCAGAAAAAGGATGG + Intronic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
993723140 5:91341458-91341480 AGGCAGAAGTAGAAACAGGGAGG + Intergenic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994191783 5:96876931-96876953 AAACAGATGAAGGAACAGGATGG - Intronic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994405250 5:99337639-99337661 GAGCAAAAGCAGTAACAAGAGGG + Intergenic
995282514 5:110352165-110352187 AATCAGCAGCAGAAAAAGAAAGG - Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996030669 5:118700929-118700951 AAGCAGCAGCAGATCTAGGATGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
997026570 5:130069802-130069824 AAGAAGAAGGAGAAACATAAAGG - Intronic
997192064 5:131946369-131946391 AAGAAGAAGAAGAAACAGATCGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997689201 5:135814226-135814248 AAGCAGAGGCAGCCAAAGGATGG - Intergenic
997736595 5:136216824-136216846 AAGCAGAAGCAGACACAGCCGGG + Intronic
998174767 5:139894974-139894996 AGGCAGAAGCTGCACCAGGAGGG + Intronic
998317551 5:141197454-141197476 AAGCACAAAAAGCAACAGGAGGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
998981526 5:147708471-147708493 ACGTAGAAGGAGAAACAGGTTGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000324276 5:160160294-160160316 TAGCAGCTGCAGAAACAGGTCGG - Intergenic
1000551709 5:162674013-162674035 AAGCAGAAGCAGAAAACAAAAGG - Intergenic
1000972038 5:167725594-167725616 AAGCTGTTGCAGAAACAGGGAGG - Intronic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001465115 5:171957368-171957390 AAGCAGGAGCAGAAAAGGGGAGG + Intronic
1001989580 5:176105172-176105194 GAGCAGAAGCACAAACACCATGG + Intronic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002227292 5:177732966-177732988 GAGCAGAAGCACAAACACCATGG - Intronic
1002266852 5:178040804-178040826 GAGCAGAAGCACAAACATCATGG + Intronic
1002440277 5:179260838-179260860 AAGCAGTAGCGGGAACAGCAGGG - Intronic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003467237 6:6392459-6392481 CAGCAGTGGCAGGAACAGGAAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003521315 6:6861029-6861051 GAGCAAGAGCAGGAACAGGAAGG + Intergenic
1003571863 6:7261320-7261342 AAGCAAAACCACACACAGGACGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1004115212 6:12760100-12760122 AAGCAGAAGGAGAAACATAATGG - Intronic
1004290074 6:14358745-14358767 AAACAGAAACAGAGAAAGGAAGG - Intergenic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404982 6:15324481-15324503 AAAAAGAAGAAGAAAAAGGAGGG - Intronic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004490478 6:16110315-16110337 TGGCAAAAGCAGAAATAGGAAGG + Intergenic
1004564864 6:16786803-16786825 AAGCAGGAGCCCAAACATGAAGG + Intergenic
1005019480 6:21404056-21404078 CAGCAGCAGCTGGAACAGGAGGG - Intergenic
1005364887 6:25066925-25066947 AAAAAGCAGCAGATACAGGATGG + Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006205934 6:32342896-32342918 AAGGAGAAGCAGTTAAAGGAAGG + Intronic
1006467358 6:34203565-34203587 ATGCAGAAGCAGGAAAAGAATGG + Intergenic
1006520627 6:34568997-34569019 TAGTGGAAGCAGGAACAGGACGG + Intergenic
1006953965 6:37850183-37850205 AAACATAACCAGAAGCAGGATGG + Intronic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007496035 6:42260873-42260895 AAGCTGAGGGAGAAACAGAAGGG - Intronic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008723642 6:54390062-54390084 AAGCAGAAGCATAGACCAGAGGG - Exonic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1008867722 6:56234727-56234749 AAGCAGAGGAAGATAAAGGAGGG - Intronic
1010303500 6:74288807-74288829 AAGAAAAAGCAGAAACTGAATGG - Intergenic
1011133870 6:84078751-84078773 AAGCAGACCCATAAAAAGGAAGG - Intronic
1011169738 6:84492206-84492228 AAGCAGAAGCAGAAAAATTTAGG + Intergenic
1011484727 6:87829897-87829919 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1012565587 6:100645782-100645804 AAACAGAAACAAAAACATGATGG + Intronic
1012668918 6:102015653-102015675 AAGCAGTAGCAGCAGCAGCACGG - Intronic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013312852 6:108913777-108913799 AACCAGAAGGAGAAACAGGGAGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013611069 6:111795644-111795666 TAGCAAAATCAGAAACAGAAGGG + Intronic
1013643354 6:112110370-112110392 GAGCAGTAGCAGATAAAGGATGG + Intronic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1014755465 6:125297794-125297816 AAGCAGAAGCTGGAAAATGAAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015585591 6:134772824-134772846 TAGCAAAAGCAGAAGCAAGATGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017058582 6:150459749-150459771 AAGCAGAGGAAGGAACAGAATGG - Intergenic
1018153860 6:160966612-160966634 GATCACAAGGAGAAACAGGAAGG - Intergenic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1018783663 6:167091745-167091767 AAGCAGCATCAGAGCCAGGAAGG + Intergenic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1019115326 6:169756042-169756064 AATCAAAAGGAGAAACATGATGG + Intronic
1019363744 7:619756-619778 AAACAGAAGCACAAAGAAGAGGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1020878927 7:13734574-13734596 AATCAGAAGCAGTTACTGGAGGG - Intergenic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021201593 7:17733737-17733759 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1021382781 7:19988482-19988504 AAGCAAAAGCAGTACCAAGAGGG - Intergenic
1021941987 7:25687093-25687115 AAGCAGAAGCCAAAACCAGAAGG + Intergenic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022488125 7:30795873-30795895 AAGCAGAAGAGGGAGCAGGAAGG - Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023129960 7:36992865-36992887 AAGAAAAAGCAGAAAAAGTAAGG - Intronic
1023135462 7:37047292-37047314 AAGGAAAGGCAGAGACAGGAAGG - Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023795728 7:43790301-43790323 AACCAGGAGCAGAAGCAGGAGGG - Intronic
1024032259 7:45471425-45471447 AAGAAGGAGGAGAAACAAGAAGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024378861 7:48671132-48671154 AAGAAGAAGCACATACAGAATGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026596814 7:71739760-71739782 AAGTAGAAGCTGAAACAGAGAGG - Intergenic
1027627183 7:80560778-80560800 AAGCACAATCAGAAACAACATGG - Intronic
1027723615 7:81774749-81774771 AAGTGGTAGCAGAAACAGAATGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030398524 7:109018962-109018984 AAGGAGAAGGAAAAACAGAAAGG + Intergenic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1031995460 7:128227487-128227509 AATCAGAAGCACCATCAGGAAGG - Intergenic
1032069595 7:128795573-128795595 AAGCAAAGGTAGATACAGGAAGG + Intronic
1032832305 7:135640569-135640591 AAACAGAAGCAGACACTGGTAGG - Intronic
1032996688 7:137454897-137454919 AAGCATAAGTTGAAACATGAGGG + Intronic
1033168693 7:139064563-139064585 ACCCAGAATCAGAAACAGCATGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033318616 7:140319206-140319228 GAGCAGAAAGAGAAACAGGATGG + Intronic
1033509307 7:142039059-142039081 TAGCAAAAGCAGGAACAAGACGG + Intronic
1033564372 7:142564283-142564305 AAGGAGAAGGAGAAACACCAGGG - Intergenic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033708292 7:143910243-143910265 AAACAGAAGCATAAACATCAAGG + Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1034220841 7:149444955-149444977 AAAGAGTAGCAGAAACAGGTGGG - Intronic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1035428133 7:158795878-158795900 AAGCAGCAGCACATACAGGCAGG + Intronic
1037312184 8:17567978-17568000 ATTCACAAGCAGAAACAGAAAGG - Exonic
1037407261 8:18556037-18556059 AAACAGAATCACAAACAAGAGGG + Intronic
1037761202 8:21742934-21742956 AAGCAGTAGCAGCCACAGCAGGG + Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038326806 8:26577972-26577994 AAGGAGAGAGAGAAACAGGAGGG - Exonic
1038388013 8:27167825-27167847 AAGCAGATGCTGACACAAGACGG - Intergenic
1038848017 8:31247806-31247828 AAACTGAAGGAGAAATAGGATGG + Intergenic
1039244222 8:35590741-35590763 AAGCTGAAGCAGAAACATTGAGG + Intronic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039839406 8:41283101-41283123 AAAGAGAGGAAGAAACAGGATGG - Intronic
1040063626 8:43126395-43126417 AGGCAGGAGGAGCAACAGGAGGG - Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042120399 8:65481259-65481281 AGGAAGAAGAAGAAACAGGTGGG - Intergenic
1042592814 8:70414265-70414287 AGGCAGAGGCAGAAAGAGAAGGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044501288 8:92961323-92961345 AAGCAGAATCGGAAACTGGGAGG + Intronic
1044537209 8:93370968-93370990 AAGGAGAGGCACAAACAAGAAGG + Intergenic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045550973 8:103172124-103172146 AAACAGAAGTAGATACAGGCAGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046840343 8:118849409-118849431 AAGCAGAAACACAGACGGGAGGG - Intergenic
1047196311 8:122725110-122725132 AACCAGAAGGAGAAACACAAGGG - Intergenic
1047556971 8:125942120-125942142 CAGAAAAACCAGAAACAGGAAGG - Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1048202595 8:132388060-132388082 AAGAAGAAGAAGAAACATAAAGG + Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049263711 8:141653659-141653681 ATGCAAAACCAGGAACAGGAGGG + Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050513611 9:6419454-6419476 AAGCAGAAAAAAAAACAAGAAGG - Intronic
1050692184 9:8240581-8240603 AAACAGAAACAGAAACAGGTAGG + Intergenic
1050913013 9:11099021-11099043 AGACAGCAGCAGAAACAAGAAGG + Intergenic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1051719228 9:20018481-20018503 AAGGAGAAGAAGCAACAGCATGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052014508 9:23449250-23449272 AATCAAAAGCAGAACCATGATGG + Intergenic
1052078897 9:24179171-24179193 AAACACAATCAGAAACAAGAGGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052375434 9:27713400-27713422 AACCTGAGGCAGAAACAGAATGG + Intergenic
1052804326 9:32999619-32999641 AAGCAGAGGCAGAAATGTGAGGG + Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053069399 9:35092222-35092244 AAACAGCAGGAGTAACAGGACGG + Exonic
1053147942 9:35724547-35724569 AAGCAGAACTAGAAAAAAGAGGG - Intronic
1053392824 9:37747960-37747982 CAGCAAAAGCAGGAACAGAAAGG + Intronic
1053421116 9:37979258-37979280 AAGCAGAAACATTAACAGGATGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053800454 9:41760726-41760748 CATCAGAAGCTGGAACAGGATGG + Intergenic
1054188884 9:61972878-61972900 CATCAGAAGCTGGAACAGGATGG + Intergenic
1054649634 9:67615739-67615761 CATCAGAAGCTGGAACAGGATGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055798863 9:80009097-80009119 CTGCAGTAGCAGAAACACGATGG + Intergenic
1056796098 9:89659902-89659924 GAGCAGAAGCAGAAACCTGGAGG - Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1056947756 9:91014170-91014192 CATCAGATGCAGAGACAGGAAGG + Intergenic
1057043352 9:91864012-91864034 AAGCAGACGCAGAAACAAAGTGG + Intronic
1057089177 9:92240895-92240917 ATGCACAAGCAGGACCAGGAAGG + Exonic
1057411730 9:94822255-94822277 AAGCTGAAACAGCAGCAGGAGGG + Intronic
1058130496 9:101247309-101247331 AAACAGAAGCAGCAACACAAAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058779337 9:108317669-108317691 AAATAGAAGCAGAAAAAGAATGG + Intergenic
1058863894 9:109144126-109144148 AGGCAGCAGGAGAAACAGCAGGG - Intronic
1058930768 9:109716728-109716750 AAACAGAAGCAATTACAGGAAGG + Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059199459 9:112400620-112400642 AAACAGAACCACAAACTGGATGG + Intronic
1059422250 9:114199508-114199530 CAGCAGAAGCAAACACAGGGAGG - Intronic
1059506897 9:114807364-114807386 AACCAGAAGTAGCAACTGGATGG - Intergenic
1060214884 9:121732779-121732801 AAGCAGAAGCACAGAAAGGTTGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061378932 9:130242770-130242792 CAGCAGTAGCACACACAGGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203365408 Un_KI270442v1:251028-251050 AAGAAGAAGCAAACACAGGAAGG - Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1185921758 X:4100849-4100871 AAGGAGGAGGAGAAACAAGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1187167544 X:16818543-16818565 AAGGAGAAGGAGAAAAAAGATGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1189094473 X:38123609-38123631 CAGCAGAAGCTTAAACTGGATGG - Intronic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189248554 X:39582025-39582047 GAGCAGGAGCAGCAACAGGGTGG + Intergenic
1189277336 X:39796527-39796549 AAGCAGTTGCAGAGACAGAAGGG + Intergenic
1189285645 X:39850518-39850540 AAGGAGGAGCAGAAACATAAGGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189713599 X:43841363-43841385 AAGCTGAAGCAAAAACAAGAAGG + Intronic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190384714 X:49873902-49873924 AAGAAGAAGAAGAAACAATAAGG + Intergenic
1190747676 X:53334841-53334863 AGGCAAAACCAGAAACAAGAAGG + Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1192015809 X:67329420-67329442 CAGCAAAAGCAGAACCAGTATGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192449357 X:71233834-71233856 AAGCTGGAGCAGAAACAGAAAGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194116284 X:89902521-89902543 AAAAATAATCAGAAACAGGAGGG + Intergenic
1194120235 X:89952742-89952764 AAACAGAAACAAAAACATGAAGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1195011671 X:100738166-100738188 GAGCATAAGCAAAAACAGAAAGG + Intergenic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196076489 X:111583270-111583292 TAGCAGATGAATAAACAGGAAGG + Intergenic
1196089524 X:111725095-111725117 AAGTAAAAGCAGGTACAGGAAGG - Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196524873 X:116720135-116720157 AAGCAGAAGTTGAAACAGTTTGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1197645707 X:129014392-129014414 AAAAAGAAGCAGAAATAGCAGGG + Intergenic
1197844211 X:130783910-130783932 AAGTTGCCGCAGAAACAGGAGGG - Intronic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198735892 X:139784786-139784808 AAGCAGTAGGGGAACCAGGAAGG + Intronic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1199098844 X:143774376-143774398 AATTTGAAGCAGGAACAGGAAGG + Intergenic
1199185762 X:144913038-144913060 AAACAGAAGCAACAGCAGGAAGG + Intergenic
1199706008 X:150426030-150426052 AAGCAGGACCTGAAACAGAAAGG - Intronic
1199781208 X:151061690-151061712 CAGCAGGAGCAGAAACATGGTGG - Intergenic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic