ID: 1186073328

View in Genome Browser
Species Human (GRCh38)
Location X:5847704-5847726
Sequence TCTGGAGACACATATTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186073323_1186073328 -6 Left 1186073323 X:5847687-5847709 CCGTAATAATGGACCCATCTGGA 0: 1
1: 0
2: 0
3: 11
4: 66
Right 1186073328 X:5847704-5847726 TCTGGAGACACATATTGAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186073328 Original CRISPR TCTGGAGACACATATTGAAG GGG Intronic
902107983 1:14053549-14053571 TCTGATGACACTTATTGAAATGG + Intergenic
902923555 1:19681078-19681100 TCTGGGGTCCCAGATTGAAGGGG - Intergenic
905598506 1:39230029-39230051 TTGGGACACACATATTGCAGTGG - Intronic
905598609 1:39230803-39230825 TTGGGACACACATATTGCAGTGG - Intronic
906833798 1:49061353-49061375 TCTGGAGACTGATATTCAAGGGG - Intronic
909563454 1:77029603-77029625 TATGGAGTCACAGATGGAAGTGG - Intronic
911887133 1:103317476-103317498 TCTGAATACACATTTTGAAATGG + Intergenic
914204752 1:145517406-145517428 TCAGGAGCCACATAGTGAATTGG + Intergenic
914370809 1:147022821-147022843 TCAGGAGCCACATAGTGAATTGG - Intergenic
917580903 1:176376899-176376921 TCTAGAGATACATATTTGAGAGG - Intergenic
918176403 1:182049919-182049941 GCTGGAGACACATTTGGAAGTGG + Intergenic
919279224 1:195465644-195465666 TTAGGAGATAAATATTGAAGTGG - Intergenic
921352065 1:214245976-214245998 TCTGGAGACACATACATAATGGG + Intergenic
923424935 1:233859397-233859419 TCTGCAGACACTTATGAAAGGGG - Intergenic
1063264202 10:4428728-4428750 GATGGAGACACTTATTGAAATGG - Intergenic
1065767347 10:29042569-29042591 ATTAGAGACACAAATTGAAGAGG + Intergenic
1067792869 10:49301030-49301052 CCTGGAGACCCTTACTGAAGAGG + Intronic
1068275682 10:54792803-54792825 TCTGGAGATACAGAATGAATAGG - Intronic
1068812776 10:61275295-61275317 TCTGGAGAAACAGAGTTAAGAGG + Intergenic
1071224868 10:83517167-83517189 CATGGAGACAAATATTTAAGAGG - Intergenic
1072411265 10:95204069-95204091 TCTGGTGACCCAGACTGAAGTGG - Intronic
1073947644 10:108769250-108769272 TCTGTAGACACAGAGTGATGAGG - Intergenic
1075419962 10:122293448-122293470 GCAGGGGACACACATTGAAGAGG + Intronic
1076203263 10:128574750-128574772 TTTCCAGACACATTTTGAAGTGG + Intergenic
1078505288 11:11935783-11935805 TCTGGAGGCTAATATTGAAAGGG + Intronic
1080847239 11:36037026-36037048 TCTGCAGAGACAAACTGAAGAGG - Intronic
1081487343 11:43541775-43541797 TCTGGAGCCACAAAATGAACAGG + Intergenic
1085681881 11:78583677-78583699 TCTGGAATCACAAATGGAAGAGG - Intergenic
1086650620 11:89284804-89284826 TCTGGATAAACTTCTTGAAGAGG - Exonic
1088033258 11:105277935-105277957 TCTGGAGATAACTAGTGAAGGGG - Intergenic
1088971034 11:114774971-114774993 TCTGTAGACAGATATTGAAAAGG - Intergenic
1090995162 11:131859558-131859580 TCTTGAGACACATACTCGAGTGG + Intronic
1091706502 12:2697079-2697101 GCTGGAGACACCTCCTGAAGGGG - Intronic
1092781498 12:11991809-11991831 TCTGGGGACACAGATTGGAAGGG + Intergenic
1095376278 12:41532550-41532572 TCTGTTGACAAATATTAAAGAGG - Intronic
1097321854 12:58234313-58234335 ACTGGAGACAGACATTGAATTGG + Intergenic
1097406480 12:59196277-59196299 TTTGGAAATACATATTGAAATGG + Intergenic
1103133920 12:118491335-118491357 TCTGTAGTCACATATCCAAGTGG - Intergenic
1103380232 12:120488485-120488507 TGTGGAGACAGACATTGAACAGG - Intronic
1105523205 13:21150532-21150554 GCTGAAGGCACAAATTGAAGAGG - Intergenic
1105580831 13:21693986-21694008 TCTGGAAGGACATATTGAACAGG - Intronic
1109296086 13:60532433-60532455 TCTGAAACCACAAATTGAAGAGG + Intronic
1109310909 13:60692370-60692392 CTTTGAGACACATATTGAAAGGG - Intergenic
1111614508 13:90645508-90645530 TCTTGTGAGCCATATTGAAGGGG - Intergenic
1112065547 13:95788963-95788985 TCTGAAGCCACATATTTAGGAGG - Intronic
1113169372 13:107482362-107482384 TCTGGAGACACATAACCAATAGG - Intronic
1114280352 14:21188238-21188260 TCCTGAGACACTTCTTGAAGTGG - Intergenic
1120165228 14:81191334-81191356 TCTGGGGACACAAATGCAAGAGG - Intronic
1120412863 14:84179115-84179137 TCTGGAAACAGAAATTTAAGTGG + Intergenic
1120671983 14:87373132-87373154 ACTGGAGAAACATAAGGAAGGGG - Intergenic
1121196634 14:92078779-92078801 TTTAGAGACACATATTAAAATGG + Intronic
1123894119 15:24811200-24811222 TCTGGAGAAACAAATAGAGGTGG + Intergenic
1124117550 15:26860195-26860217 ACAGGAGACACATATTAGAGTGG + Intronic
1126125922 15:45294241-45294263 TCAGGAGAGTCATATGGAAGGGG - Intergenic
1130217357 15:81984800-81984822 TTTGGAGACACATATTGATATGG - Intergenic
1130354420 15:83116920-83116942 TCTGCAGACATTTGTTGAAGGGG + Intronic
1131871502 15:96769041-96769063 TCTGGAGAAATGTCTTGAAGTGG - Intergenic
1138035362 16:53599831-53599853 GCTGCTGACACATTTTGAAGTGG - Intronic
1138903334 16:61301008-61301030 TCTAGAGATAAATTTTGAAGGGG - Intergenic
1145102832 17:20090921-20090943 TCTGGAGACCCATAAGGAATAGG - Intronic
1147117786 17:38314956-38314978 GCAGGAGAGACATAATGAAGTGG - Intronic
1153017200 18:594660-594682 CATAGAGACTCATATTGAAGTGG - Intergenic
1153142591 18:1991574-1991596 TTTGTAGACTAATATTGAAGAGG - Intergenic
1153708970 18:7778233-7778255 TCTGGAAATACATATTTAGGGGG + Intronic
1156153222 18:34267646-34267668 TCCAGAGAAACATAATGAAGAGG - Intergenic
1157041670 18:44046822-44046844 TTCGGAGACACATGCTGAAGGGG + Intergenic
1157873597 18:51251825-51251847 TCTGCAGACACAGATGCAAGGGG + Intergenic
1158387706 18:57013746-57013768 GCTGCAGAAACATCTTGAAGAGG - Intronic
1159823497 18:73176359-73176381 GATGGAGACAGACATTGAAGCGG + Intronic
1160423043 18:78761845-78761867 TCTAGAGACACATAGTCCAGTGG - Intergenic
1163674713 19:18649770-18649792 TCCGGAGAGACATGTGGAAGGGG - Intronic
1164977564 19:32584854-32584876 TGTGGAGACACATACTGGATGGG + Intronic
1165529598 19:36386858-36386880 TCTGGAGACAGAGGTTGCAGTGG + Intronic
1166271322 19:41716041-41716063 TCTGTAGAGACATATTGGGGAGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
925418015 2:3686601-3686623 ACTGGTGAAATATATTGAAGAGG - Intronic
925770876 2:7282128-7282150 TCTGGAGACCCATGTTGCTGTGG + Intergenic
930192825 2:48478019-48478041 TCTGGAGACAGAGATACAAGGGG + Intronic
932684180 2:73853874-73853896 TTTAGAGATACACATTGAAGTGG - Intronic
933294153 2:80470840-80470862 TCTGGAGACAGATAAAAAAGGGG + Intronic
933478377 2:82821252-82821274 GCTTAAGACACATATTGAAATGG + Intergenic
933842993 2:86302781-86302803 CCTGGAGATACATTTTGGAGGGG - Intronic
934880840 2:97977250-97977272 TCTGGAGATACATATTTACAAGG - Intronic
941195274 2:162443109-162443131 TCTGGAGACACATATTTGACAGG - Intronic
941888994 2:170558470-170558492 TTTAGAGACACATATTTAGGTGG - Intronic
943184778 2:184594011-184594033 TCAAGAGACACATCTTCAAGTGG + Intergenic
944312994 2:198255902-198255924 TCTGTAGACACATTTTGAGTCGG - Intronic
945941060 2:215950762-215950784 TTTGGAGTCACATGTTTAAGAGG - Intronic
947454265 2:230238966-230238988 TCTGGAGAAAGAAGTTGAAGTGG + Intronic
948092233 2:235303892-235303914 TCCGGAGACAGCTTTTGAAGAGG - Intergenic
948204382 2:236155342-236155364 TAAAGAGACACATAATGAAGAGG - Intergenic
1168806167 20:673540-673562 TCTGGAGACCCATGGGGAAGGGG + Intronic
1171250555 20:23642923-23642945 TCTGTAGACACTTATTAAAATGG - Intergenic
1174169066 20:48604975-48604997 ACAGGAGACAGACATTGAAGAGG - Intergenic
1175281520 20:57807063-57807085 TCTGGACCCACATGTAGAAGCGG + Intergenic
1176888075 21:14280925-14280947 TTTTGAGATACTTATTGAAGGGG + Intergenic
1176989560 21:15478919-15478941 CCTGAAGACACAAATTAAAGAGG + Intergenic
1178140632 21:29679464-29679486 GCTGGAGACACAAATTTGAGTGG - Intronic
1181727679 22:24822781-24822803 TCTGGAGCCCCATGTTGCAGTGG - Intronic
1185097526 22:48819539-48819561 TCTGGGAACACAGATTGCAGTGG - Intronic
949525998 3:4904371-4904393 TCTGGAAATTCCTATTGAAGTGG + Intergenic
949619805 3:5797914-5797936 TCTGGAGACCCAGGTGGAAGTGG + Intergenic
953276559 3:41506330-41506352 CCTGGAGACAGTTATTCAAGTGG + Intronic
954321932 3:49838170-49838192 TCTGGGCATAAATATTGAAGTGG - Intronic
954932326 3:54295104-54295126 AGTGGAGACACATAGAGAAGAGG + Intronic
956647981 3:71475450-71475472 TCTGGAGGCACAAATCAAAGGGG + Intronic
957024118 3:75160374-75160396 ACTGGAGACAGGGATTGAAGAGG - Intergenic
960894175 3:122484200-122484222 TCTGGAGGCAAATTTTTAAGAGG - Intronic
961377841 3:126478674-126478696 GGTGGAGACACATCATGAAGTGG - Intergenic
962974964 3:140437994-140438016 TTTGGATACACCTATAGAAGGGG - Intronic
964863866 3:161232010-161232032 TCTGAGGACACATAGTGCAGTGG + Intronic
966476374 3:180352528-180352550 TATGGAAACATATTTTGAAGTGG + Intergenic
969355990 4:6626214-6626236 TCTGGAGACACAACTTGGAGAGG + Intergenic
971664568 4:29465516-29465538 TCTGGAGAAATAGATTTAAGTGG - Intergenic
973637778 4:52876004-52876026 TCGGGAGACACACATTCAAACGG - Intronic
973991248 4:56409770-56409792 TCTACAGGCACATATGGAAGAGG - Intronic
975161716 4:71132288-71132310 TCTCCAGACACATGTTGACGGGG + Intergenic
978512191 4:109532678-109532700 TCTGCAGACAATTTTTGAAGAGG - Exonic
980141100 4:128918235-128918257 TCTGATGACAGATATTGGAGTGG + Intronic
980410547 4:132413117-132413139 GCAGGAGACACAGAGTGAAGGGG - Intergenic
980524124 4:133967423-133967445 TTTGGAGATATATATTAAAGTGG + Intergenic
980715044 4:136617035-136617057 TCGGGAGACACATAAAGCAGTGG - Intergenic
982280528 4:153679863-153679885 TATGAAGACACAACTTGAAGAGG - Intergenic
982282992 4:153704911-153704933 TATGAAGACACAACTTGAAGGGG - Exonic
983002822 4:162439928-162439950 TATTGTGACAAATATTGAAGAGG - Intergenic
983887803 4:173000302-173000324 TCGGGAGACATATAATGTAGTGG - Intronic
984043272 4:174764365-174764387 TAAGCAGACACATATGGAAGAGG + Intronic
985341205 4:188956506-188956528 AATAGAGAAACATATTGAAGGGG + Intergenic
987173180 5:15280050-15280072 TCTGGGGTCACTTATTTAAGTGG - Intergenic
990194191 5:53294535-53294557 GCTGGAGCCACATAGTGTAGTGG - Intergenic
990328978 5:54706785-54706807 GTTGGACAGACATATTGAAGTGG - Intergenic
991396297 5:66208519-66208541 TCTGGAGACACATCTTGGTGGGG - Intergenic
994274838 5:97822933-97822955 TGTGGAAAGAGATATTGAAGAGG - Intergenic
995404039 5:111774042-111774064 TCTGGGAATACATATTGAATGGG - Intronic
995874027 5:116771516-116771538 TTTGGCCACACACATTGAAGAGG - Intergenic
996321097 5:122218107-122218129 TCAGGAGACACAGATCAAAGGGG - Intergenic
999134419 5:149308693-149308715 TGTGGAGAAAAATATAGAAGGGG - Intronic
999545196 5:152621430-152621452 TCTGGAAAGACATATAGAACTGG + Intergenic
1000197307 5:158972183-158972205 GCTGGGGACACAGATTGAGGTGG - Intronic
1000475146 5:161697592-161697614 TCTGGAGATACAACTTGAGGTGG + Intronic
1001975217 5:175993295-175993317 TCTGGAGAGAAGGATTGAAGGGG - Intronic
1002242214 5:177850475-177850497 TCTGGAGAGAAGGATTGAAGGGG + Intergenic
1002586910 5:180254569-180254591 TCTGGAAGCACATATTATAGAGG - Intronic
1004291296 6:14369862-14369884 TGTGGGGACACAGGTTGAAGTGG + Intergenic
1007712949 6:43836265-43836287 CCTGGTGACACCTACTGAAGGGG + Intergenic
1008017652 6:46540085-46540107 TCTGGAGAAAGAAACTGAAGAGG + Intergenic
1009531751 6:64826504-64826526 TCTGGAGGCAGATGTTGAGGCGG - Intronic
1011872232 6:91910522-91910544 TCTGGAGAAACATTTTTAATTGG - Intergenic
1013334662 6:109143559-109143581 TGTGTAGACACATATTAAAGTGG - Intronic
1014706804 6:124757884-124757906 GGTGTTGACACATATTGAAGTGG - Intronic
1015126578 6:129761874-129761896 TCTGGGGACAGATAAAGAAGTGG + Intergenic
1017977886 6:159374225-159374247 TCTGTAGTCACATGTTGATGAGG - Intergenic
1020843917 7:13258670-13258692 TTTGGAAACATATATTAAAGTGG - Intergenic
1021018125 7:15561491-15561513 TCTGGAGTGACATATAAAAGAGG + Intronic
1021764613 7:23934803-23934825 TCTGGAATCATTTATTGAAGAGG + Intergenic
1025014458 7:55427795-55427817 TATGGAAACACCCATTGAAGAGG + Intronic
1026302229 7:69107995-69108017 GCTGTATACAGATATTGAAGAGG + Intergenic
1027858770 7:83548008-83548030 ACTGGAGCCAGATATGGAAGAGG - Intronic
1031155554 7:118106685-118106707 ACTGCAGACACATAATGGAGTGG - Intergenic
1032044011 7:128587699-128587721 TCTGGAGGCCCAGCTTGAAGTGG + Intergenic
1032412266 7:131704802-131704824 TTTGGAGACATATTTTGGAGTGG + Intergenic
1035402219 7:158574035-158574057 TCTTTAGACACATTTTGAAGTGG + Intronic
1036710873 8:11077788-11077810 TCTGCTGACACAGATTGGAGCGG - Intronic
1038434104 8:27522650-27522672 TCTGGTGACACATTATAAAGAGG + Intronic
1039739108 8:40363684-40363706 TCTGCAGAAAGACATTGAAGTGG - Intergenic
1043112918 8:76210619-76210641 TATGGAGACAGCAATTGAAGTGG - Intergenic
1044532680 8:93325524-93325546 TCTGGAGAGAAATATAGATGTGG + Intergenic
1045998652 8:108393689-108393711 TGTGGAGACTAATATTCAAGTGG - Intronic
1046269330 8:111872688-111872710 TGTGGAGACATATATAGATGTGG + Intergenic
1048127768 8:131656393-131656415 ACTAGAGACAGATATAGAAGAGG - Intergenic
1048527655 8:135217964-135217986 TCTGCAGTTACATATTGATGTGG + Intergenic
1048707770 8:137173296-137173318 ACTGGAGACACATATGGAAAAGG - Intergenic
1050613506 9:7377739-7377761 TCTGGAAACACTCACTGAAGAGG - Intergenic
1051665929 9:19466893-19466915 TCTGAAGACATGTATAGAAGTGG + Intergenic
1052936553 9:34098125-34098147 ACTGCAGACACCAATTGAAGGGG + Intronic
1053157290 9:35790563-35790585 TCTGGAGAAATAGCTTGAAGGGG + Intergenic
1055354000 9:75418465-75418487 TAGGGAGGCACATATTAAAGCGG + Intergenic
1056159472 9:83874086-83874108 TCTGGAGCAACATGTGGAAGAGG - Intronic
1056351099 9:85749839-85749861 TCTGGAGCAACATGTGGAAGAGG + Intergenic
1056723103 9:89088436-89088458 GCTGGAGACACAGTTTCAAGAGG - Intronic
1057481645 9:95449313-95449335 GCTGGAGACACCTATTTAAGGGG + Exonic
1059086842 9:111312355-111312377 TCTGGTGAAAGAAATTGAAGAGG - Intergenic
1059868324 9:118542656-118542678 TCTGGATACATCTATGGAAGTGG - Intergenic
1060199551 9:121644798-121644820 TCTGGGGTCACACAGTGAAGAGG + Intronic
1061184738 9:129046171-129046193 TCTTGAGACTAATATGGAAGAGG + Intronic
1061679914 9:132237905-132237927 TCTGGAGGGACAAAGTGAAGGGG + Intronic
1186073328 X:5847704-5847726 TCTGGAGACACATATTGAAGGGG + Intronic
1186659985 X:11659951-11659973 TCTGAAGACACAACTGGAAGTGG - Intronic
1187390768 X:18885258-18885280 TATGAAGAGAAATATTGAAGGGG - Intergenic
1187781768 X:22834812-22834834 TCTGGAGGCACAACTTGAAGTGG - Intergenic
1188733891 X:33687897-33687919 CCTGGAGACACATAGGTAAGTGG - Intergenic
1189246032 X:39564269-39564291 TTTGGAGACACAGAGGGAAGAGG - Intergenic
1198561952 X:137859829-137859851 TCTGAAGAGAAATATTGAAAAGG + Intergenic
1198574743 X:137997917-137997939 TATGGAGAGACATACTGAAGAGG - Intergenic
1198944939 X:142000725-142000747 TAAGGAGACACAGGTTGAAGAGG + Intergenic