ID: 1186075649

View in Genome Browser
Species Human (GRCh38)
Location X:5875298-5875320
Sequence GTGTGTCCCACAAGCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186075646_1186075649 11 Left 1186075646 X:5875264-5875286 CCAGCCTGTAAGCTCTTCTTCTA 0: 1
1: 0
2: 1
3: 29
4: 239
Right 1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 144
1186075645_1186075649 12 Left 1186075645 X:5875263-5875285 CCCAGCCTGTAAGCTCTTCTTCT 0: 1
1: 0
2: 5
3: 26
4: 362
Right 1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 144
1186075647_1186075649 7 Left 1186075647 X:5875268-5875290 CCTGTAAGCTCTTCTTCTATTTA 0: 1
1: 0
2: 0
3: 23
4: 229
Right 1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 144
1186075644_1186075649 20 Left 1186075644 X:5875255-5875277 CCACTGCGCCCAGCCTGTAAGCT 0: 1
1: 8
2: 131
3: 884
4: 4967
Right 1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186075649 Original CRISPR GTGTGTCCCACAAGCCTGGA AGG Intronic
900211768 1:1459710-1459732 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900224577 1:1527010-1527032 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
903642282 1:24868210-24868232 GTGTCTGGGACAAGCCTGGAAGG + Intergenic
904267646 1:29326815-29326837 GTGTGTCTCACCAGCCTGACGGG + Intergenic
907267284 1:53270526-53270548 GGAGGTCCCACAAGCCTGGGTGG + Intronic
916852110 1:168714114-168714136 GGGTCACACACAAGCCTGGAAGG - Intronic
1062791442 10:308891-308913 GGGTGTCCCAACAGCCTGCATGG - Intronic
1067227871 10:44387000-44387022 ATCTGTCCCAGAAGCCTGAAAGG + Intergenic
1067282855 10:44886024-44886046 CTGTGTCCCCCAAGCCTGGCAGG + Intergenic
1075723002 10:124598233-124598255 GAGCGTCCCATCAGCCTGGAGGG + Intronic
1076043168 10:127268858-127268880 GTGTGTCCCACATGCCAGGCAGG - Intronic
1076121912 10:127943387-127943409 GTCTCTGCCACCAGCCTGGAAGG + Intronic
1076802781 10:132839084-132839106 GTGTGTCCCACATGGATGAAGGG - Intronic
1076883364 10:133250147-133250169 GTGTTTCCCAGAAGCCTCGCCGG - Intergenic
1077259570 11:1608683-1608705 GGGTGTCCCAGGAGCCTGGGAGG + Intergenic
1077677070 11:4204495-4204517 TTATGTCCCAGAATCCTGGAGGG + Intergenic
1077871582 11:6266832-6266854 GTTTGTCACACAAACCTAGAAGG + Intronic
1078418378 11:11184830-11184852 CTGTGTCCCACAGGACTGGCCGG + Intergenic
1081056524 11:38416182-38416204 GAGAATCCCACAAACCTGGATGG + Intergenic
1083227466 11:61294228-61294250 GTGTGAGCTACAAGCCTGGCCGG + Intronic
1085053228 11:73390415-73390437 GTGTGTCCCTGAAGCCCGGGTGG + Intronic
1086092751 11:83020618-83020640 GTGAGTCCCACAAACCAGGGTGG + Intronic
1087742247 11:101901364-101901386 TTTTCTCCCACAAACCTGGAAGG + Intronic
1087894769 11:103575363-103575385 CTGTGGCCCACAACTCTGGAGGG - Intergenic
1092743600 12:11653053-11653075 GTCTGTCCTACAACCCTTGAAGG + Intronic
1092804368 12:12206123-12206145 GTGTGTTACACAAACCTAGATGG - Intronic
1095628452 12:44345178-44345200 GTGAGTCCCACTGGCATGGATGG - Intronic
1096518173 12:52169866-52169888 GTGCTCCCCACAGGCCTGGAGGG + Exonic
1100402562 12:94245067-94245089 GTGTGCACCACAAGGCTGTAAGG - Intronic
1101441604 12:104708382-104708404 GTGGGTCCCACACACCTGCAGGG - Intronic
1103414843 12:120737144-120737166 GTGTGTCCCAGGGGCCTGGGAGG - Intronic
1105486020 13:20833611-20833633 GTGGAACCCACAAACCTGGAGGG + Intronic
1110759333 13:79213591-79213613 GTGTGCACCACATGCCTGGCTGG + Intergenic
1112248579 13:97756891-97756913 TTATGTCCCACAGTCCTGGAGGG + Intergenic
1113756157 13:112812479-112812501 GTGCGTTCCAGAAGCCTGGAGGG + Intronic
1116065191 14:39973082-39973104 GAGGGTCCCACAAGCCTGGGTGG + Intergenic
1118803838 14:69217004-69217026 GTGTTTACCACAGGCCAGGATGG - Intronic
1118815916 14:69313738-69313760 TTCTGTCCCACAGGCCTGGGAGG - Intronic
1121525025 14:94613701-94613723 GTGTCCACCATAAGCCTGGAAGG - Exonic
1122415854 14:101549159-101549181 GTGGATCCCACAGGCCTGGAAGG + Intergenic
1122805164 14:104252792-104252814 GTGAGTGCCACCAGCCTTGAGGG - Intergenic
1122951207 14:105046101-105046123 GACTGTCCCACAGGCCTGGTGGG - Intergenic
1123587401 15:21772500-21772522 GTGTGTCCCACAGCCCTAAAAGG - Intergenic
1123624039 15:22215065-22215087 GTGTGTCCCACAGCCCTAAAAGG - Intergenic
1124696548 15:31869260-31869282 GTGTGTCCCACCAGCTTCAAAGG - Intronic
1125501250 15:40241413-40241435 GTGTGGCCCCCAGGCCTGGTGGG + Intronic
1127363325 15:58264401-58264423 GTGGCTCCCACAAGGCTGTAAGG + Intronic
1129182334 15:73885204-73885226 CTGAGACCCAGAAGCCTGGAAGG - Intronic
1129742443 15:77995967-77995989 GTGGGGCCCACAGTCCTGGAAGG + Exonic
1129843040 15:78755510-78755532 GTGGGGCCCACAGTCCTGGAAGG - Intergenic
1129874131 15:78961579-78961601 GTGTCTCCCAGTAACCTGGACGG - Exonic
1132579979 16:680319-680341 GTGCGCCCAACCAGCCTGGACGG - Exonic
1133763762 16:8821171-8821193 GTGAGTCCCTCACTCCTGGAGGG + Intronic
1141962977 16:87421641-87421663 CTGTGTGCCACAGGCCTGCAGGG + Intronic
1143303963 17:5931438-5931460 GTGGATCCCCCAAGCATGGATGG - Intronic
1143801890 17:9390055-9390077 CTGTGTCCCCAAAGCCTGGGTGG - Intronic
1146764122 17:35503935-35503957 CTGTGGCCCACAACTCTGGAGGG - Intronic
1146973628 17:37092775-37092797 GTGTTTCCCAGAAGTCTAGAAGG - Intronic
1147969653 17:44212567-44212589 GTGTCCCCCACAGGCCAGGAGGG + Intronic
1149529813 17:57386156-57386178 GCGTGTCCAAGTAGCCTGGAAGG + Intronic
1152855032 17:82659949-82659971 GTGTGGCCCACTCACCTGGATGG + Intronic
1152964060 18:98289-98311 GGGGGTCCCACAAGCCTAGGCGG - Intergenic
1156535970 18:37864893-37864915 TTGTGTCCCACAAACCTGAAGGG - Intergenic
1157281298 18:46347923-46347945 TTGTGTCCCCCATGCCTGCACGG - Intronic
1157955128 18:52088375-52088397 TTGTGTTCCAAAATCCTGGAGGG - Intergenic
1158319846 18:56250576-56250598 ATGTGTCCCAGAAGCCTGTCTGG - Intergenic
1160158941 18:76456480-76456502 GTGGGTCCCAGAAGGCTGGCCGG - Intronic
1162367330 19:10257404-10257426 GTGTGGCCCAGAACCCTGAAAGG - Intronic
1166959880 19:46490976-46490998 GTGTGTCCCAGAGACCTGGGTGG + Intronic
1167016238 19:46842796-46842818 GGGTGTCCCAGCAGCCAGGAGGG - Intronic
1168690365 19:58373081-58373103 CTGTCTCACACAGGCCTGGAGGG - Intronic
926806633 2:16717251-16717273 CTGTGGCCCATCAGCCTGGAAGG - Intergenic
933703176 2:85270608-85270630 GTGTCTGCCACAAGCACGGAGGG + Intronic
937033780 2:118763827-118763849 GTGTTTCTCACAAGGATGGAAGG + Intergenic
937208119 2:120249846-120249868 GTGAGTCACACAGGGCTGGAAGG - Intronic
940361697 2:152803102-152803124 GTGTGTTCTACCAGTCTGGAAGG + Intergenic
944207269 2:197169754-197169776 GTGTGTATCAGAATCCTGGAAGG - Intronic
944789787 2:203113225-203113247 GGGTGTCCCACATCTCTGGAGGG + Exonic
945973329 2:216251682-216251704 GTGTCTCCCACTAGCCCTGATGG + Intergenic
946660857 2:221997922-221997944 GTGTGGGCTACAAGCATGGATGG + Intergenic
946855087 2:223943901-223943923 GTGTTTCCCAAAAGCATGGTGGG + Intronic
948337842 2:237224415-237224437 ATCTGTCCCAATAGCCTGGAGGG - Intergenic
1174398635 20:50263732-50263754 GTGTGTCTCACATGCCCGCATGG - Intergenic
1175653233 20:60747111-60747133 GAGTGTCCCATGAGCCTGAATGG - Intergenic
1177531838 21:22370865-22370887 GTGAGTCTCACAAGATTGGATGG - Intergenic
1178639141 21:34332123-34332145 CTGTGTCACACAACTCTGGAGGG - Intergenic
1184485995 22:44779925-44779947 GTGTTTCACACAAGCCCGCAGGG - Intronic
1185072839 22:48666781-48666803 GTGTCTCCCAGCAGGCTGGAGGG - Intronic
950685201 3:14612237-14612259 GTCTGTCCAACAAGACTTGAGGG + Intergenic
955141066 3:56270579-56270601 GTGTTTCCCACCAGCATGGCAGG + Intronic
958637767 3:96766556-96766578 GAGGGTCCCACAAGCCTAGGTGG - Intergenic
962154023 3:132925078-132925100 GTATGTCCCACAAGCACAGAAGG + Intergenic
962198904 3:133385443-133385465 GTCTGACCCACCAGCCTGGCAGG - Intronic
965421274 3:168462106-168462128 ATGTGTTCCACAAGACTGAAAGG + Intergenic
965561194 3:170063687-170063709 CTGTCTCCCAAAGGCCTGGACGG + Intronic
966643916 3:182221269-182221291 GTGTCTCTTAAAAGCCTGGAAGG - Intergenic
966748462 3:183300265-183300287 CTGTGTGCTCCAAGCCTGGAGGG + Intronic
966871457 3:184292589-184292611 CTGTGACCCACAGGCCTGGGTGG + Exonic
967236877 3:187393612-187393634 GAGAATCCCACAAGCCTGGGAGG - Intergenic
969345407 4:6566796-6566818 GTGTGTCCCCAAGGCCAGGATGG + Intergenic
970643892 4:18097526-18097548 CTGTGTCCCAAGAGCTTGGATGG - Intergenic
973701029 4:53537627-53537649 CTGAGTCTCACAAGCCTGGCAGG - Intronic
974993514 4:69124212-69124234 GTGTGTCCCAAAAGTCTATAAGG - Intronic
975017056 4:69434856-69434878 GTGTGTCCCAAAAGTCTACAAGG - Intergenic
976446937 4:85140779-85140801 GAGTCTCCCACACGTCTGGATGG + Intergenic
977293350 4:95186935-95186957 GTGTGTGACTCAAGGCTGGATGG - Intronic
980379231 4:131989972-131989994 GAGGGGCCCACAAGCCTGGGTGG + Intergenic
985520435 5:371680-371702 GTCGGTTCCACAGGCCTGGAAGG - Intronic
985579791 5:690556-690578 GTGGCTCCCACAGGCCTGGGAGG + Intronic
985594637 5:782615-782637 GTGGCTCCCACAGGCCTGGGAGG + Intergenic
985693204 5:1325011-1325033 CTGGGTCCCACAAGCCTGATGGG + Intronic
989424001 5:41274707-41274729 CTGTGTCCAAAAAGGCTGGAAGG - Intergenic
990089863 5:52029794-52029816 GTGTATTACACAAGCCTAGATGG + Intronic
992215619 5:74522267-74522289 GTGTGTTCTAAAAGGCTGGAGGG + Intergenic
993229240 5:85210680-85210702 GTATGTCCGACAAGCCTGGCAGG - Intergenic
995846795 5:116502284-116502306 TTGTGGGCCACAAGCCAGGACGG - Exonic
998330907 5:141326236-141326258 GTGTGTCTCAAAAGCCTGCGGGG - Intergenic
998938710 5:147257582-147257604 CTGTGGCCCACAACTCTGGAGGG + Intronic
1000161999 5:158606878-158606900 GTGTGTCTCACAAGCAAAGACGG - Intergenic
1000525778 5:162355794-162355816 GTGTTTACCAGAGGCCTGGAAGG - Intergenic
1001257901 5:170198976-170198998 GTGTGCACAAGAAGCCTGGAAGG - Intergenic
1001674022 5:173497737-173497759 GTGGGTCCCAGAGGGCTGGAAGG - Intergenic
1002028834 5:176413684-176413706 ATGTGTGCCAGGAGCCTGGATGG - Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1005091693 6:22063359-22063381 CTGTGTCCCACAAGCATGACAGG - Intergenic
1008513214 6:52296678-52296700 GAGGGTCCCATAAGCCTGGTCGG - Intergenic
1010612853 6:77976275-77976297 TTGTGTCCCAGATGCTTGGAAGG + Intergenic
1014381110 6:120743494-120743516 GTGTGTCCAACAAGTGTGGCTGG - Intergenic
1018175193 6:161172380-161172402 GTGTGTACCCCAGGCCTGGATGG - Intronic
1018299176 6:162381979-162382001 GTGTGACCCACGAGTCTGGGAGG - Intronic
1019182722 6:170201457-170201479 TTTTGTCCCAGTAGCCTGGATGG - Intergenic
1020209890 7:6150969-6150991 GTGTGTCACACAGACCTAGATGG + Intronic
1021688685 7:23211793-23211815 ATGTCTCCCACATGCCTAGAGGG - Intergenic
1024520720 7:50303117-50303139 GTGGCTCCTACAAGTCTGGAAGG + Intergenic
1028650062 7:93141142-93141164 TAGTGTCCCAAAAGCCTGCAAGG - Intronic
1029253304 7:99252132-99252154 TTATGTCCCTCCAGCCTGGAAGG - Intergenic
1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG + Intronic
1034293461 7:149950284-149950306 GTGTATTTCACAAGCCTGCAGGG + Intergenic
1034812604 7:154146569-154146591 GTGTATTTCACAAGCCTGCAGGG - Intronic
1035165769 7:156988898-156988920 GTGTGTCCCACAGGCCAGGCGGG + Intergenic
1040134184 8:43833400-43833422 TTGTTTCCCACAGGCCTGAAAGG - Intergenic
1040980073 8:53237931-53237953 GTGTCTTCCAGAAACCTGGAAGG - Intronic
1042039583 8:64577946-64577968 GTTTGTTCCAGAAGCTTGGATGG + Intergenic
1045201332 8:99984772-99984794 GTGTGTCCGTAAAGACTGGAAGG - Intronic
1047896034 8:129367406-129367428 GTGTTACCCACAGGCATGGAGGG - Intergenic
1047925205 8:129676016-129676038 GTGTGTCTGACAAGCCTGCATGG + Intergenic
1049576739 8:143393182-143393204 GTGTGTCCCACCGGCAGGGAGGG - Intergenic
1049660807 8:143818936-143818958 GTGGGTCCCTCCAGCTTGGATGG - Intronic
1050043072 9:1515697-1515719 AAGGGTCCCACAAGCCTGGGAGG - Intergenic
1052514514 9:29462773-29462795 CTGTGTCCCACAAGCAGGAAGGG - Intergenic
1053032089 9:34789083-34789105 GAGGCTCCCACAGGCCTGGATGG + Intergenic
1057911272 9:99022160-99022182 GTGTGTGTGACAAGCCTGGATGG - Intronic
1058295447 9:103300996-103301018 GCAAGTCCCACAAGCCTGGTGGG - Intergenic
1061448474 9:130655644-130655666 GTGTGTTACACTGGCCTGGAAGG - Intergenic
1062292663 9:135803972-135803994 GGGTTTCCCACAAGCCTGGCTGG - Intergenic
1062734055 9:138125496-138125518 GGGGGTCCCACAAGCCTGGGTGG + Intergenic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1186613661 X:11163961-11163983 TTGTGTCCCACAAAGGTGGAAGG - Intronic
1192210757 X:69126341-69126363 GTCTCCCCCACATGCCTGGATGG - Intergenic