ID: 1186076970

View in Genome Browser
Species Human (GRCh38)
Location X:5891193-5891215
Sequence CTAGGTCACCAATTTAAAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186076970 Original CRISPR CTAGGTCACCAATTTAAAAT GGG Exonic
905754350 1:40496088-40496110 CTAAATCACCAATTTACACTTGG - Exonic
908811950 1:67990626-67990648 CAAGGTCACAAATTTAAAAGAGG + Intergenic
911355491 1:96813389-96813411 CCAAGTCAACAATTTAAAAATGG + Exonic
915665370 1:157439631-157439653 CTATTTCTCCAATTTGAAATGGG - Intergenic
917214547 1:172664585-172664607 CCAGGTCTCCAATTTAGAAGAGG - Intronic
918504832 1:185242033-185242055 CTAGATCAACTATGTAAAATAGG + Intronic
922845681 1:228682210-228682232 ATATCTCACCAATTTCAAATCGG - Intergenic
923835829 1:237609713-237609735 CAAGGGCAGCAATTTTAAATGGG - Intronic
1063819901 10:9822235-9822257 CTAGACCACCTATTTAAAGTTGG + Intergenic
1065258630 10:23901532-23901554 CTAAGTCACCAATTAAATTTTGG - Intronic
1065551198 10:26870038-26870060 TTAGGTCACAAATGGAAAATAGG + Intergenic
1066093569 10:32050688-32050710 CTTTGGCATCAATTTAAAATAGG + Intronic
1069412160 10:68164915-68164937 CAAGGACCACAATTTAAAATTGG - Intronic
1070170554 10:73929638-73929660 CTGGGTCAGAAATGTAAAATGGG + Intergenic
1070869203 10:79734073-79734095 CCAAGTCACCAATTTTATATAGG - Intergenic
1071103729 10:82069608-82069630 TTATGTCACTCATTTAAAATTGG + Intronic
1071636116 10:87256250-87256272 CCAAGTCACCAATTTTATATAGG - Intergenic
1071659125 10:87481696-87481718 CCAAGTCACCAATTTTATATAGG + Intergenic
1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG + Intronic
1079230300 11:18643804-18643826 ATATCTCACCAATTTTAAATTGG + Intergenic
1080209797 11:29772278-29772300 CTAGCTGACTAATTAAAAATTGG + Intergenic
1084764355 11:71298437-71298459 TTATGTCAACAGTTTAAAATAGG + Intergenic
1088536111 11:110863306-110863328 CTAGGGAACTAAGTTAAAATTGG - Intergenic
1089409278 11:118225621-118225643 CTTAGTCACCACTTCAAAATAGG + Intergenic
1089529767 11:119119753-119119775 CTTGGTCCCTATTTTAAAATAGG - Intergenic
1090516150 11:127429441-127429463 CCAGGTCACTAATTTCAACTAGG + Intergenic
1092504875 12:9088041-9088063 CTAGATCTACAATTTAACATAGG + Intronic
1094759812 12:33518734-33518756 CTTTGTCACCAAATTATAATAGG - Intergenic
1095361688 12:41349485-41349507 CTATGTCTCCATTATAAAATAGG + Intronic
1098463648 12:70762146-70762168 ATATGTCACACATTTAAAATTGG + Intronic
1100003203 12:89862070-89862092 CTAGGTCAGCAATCTAGCATGGG - Intergenic
1104245116 12:127032209-127032231 CTGAGTCACTATTTTAAAATTGG + Intergenic
1107298894 13:38945161-38945183 AGAGGACACTAATTTAAAATTGG - Intergenic
1109357799 13:61253859-61253881 CTTGGTGACTAATTTAAAGTGGG + Intergenic
1109830167 13:67775723-67775745 ATTGGACACCAATTGAAAATAGG + Intergenic
1115616283 14:35097930-35097952 CTAGGTTACATATTTAAAAGTGG - Intronic
1115741712 14:36395801-36395823 TTAGGTCACAAATTGATAATAGG + Intergenic
1118393618 14:65317169-65317191 CTAGGTCACCATTTCAACAGAGG - Intergenic
1118807262 14:69249234-69249256 CTAGGTCACAATTTGCAAATTGG - Intergenic
1119248618 14:73133519-73133541 ACATCTCACCAATTTAAAATTGG - Intergenic
1120669204 14:87344720-87344742 TTATTTCACCAATTTAAAATTGG + Intergenic
1121890279 14:97583773-97583795 CCAGGTCACCCATTCAAAAATGG + Intergenic
1123826045 15:24083115-24083137 CTAGACTACCAGTTTAAAATGGG - Intergenic
1126166323 15:45657215-45657237 TCAGGTCACCACTTTAATATGGG - Intronic
1131853473 15:96567048-96567070 CTAAGTCACTCATTTAAAAAAGG + Intergenic
1134407953 16:13978870-13978892 CTAGCTCACCAGTTTGAAAAAGG - Intergenic
1135209830 16:20515591-20515613 TTAAGTCACCAATTTATAAGAGG + Intergenic
1138925457 16:61584985-61585007 CAAGGTAATCAAGTTAAAATAGG - Intergenic
1140138082 16:72225847-72225869 CTAGGTCACAGATGAAAAATTGG + Intergenic
1142044094 16:87914143-87914165 CCATGTCACCGATTTACAATAGG + Intronic
1155280973 18:24239364-24239386 CTAGGTGAGGAATTTTAAATTGG - Exonic
1155328700 18:24692291-24692313 TTAAGGCACCAATGTAAAATTGG - Intergenic
1168247914 19:55123346-55123368 ATATTTCACCAATTTTAAATTGG + Intergenic
926693201 2:15751574-15751596 CTAGGGCACCAATCTAGAAGGGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931712822 2:65003960-65003982 CTGGGTCACGACTTTATAATCGG - Exonic
939096581 2:137839601-137839623 GGAGGTCAGAAATTTAAAATAGG + Intergenic
939536854 2:143442226-143442248 CTAAGCAACCAATTTACAATTGG - Intronic
940799382 2:158116493-158116515 CAAGGTTACCAATTAGAAATGGG + Intronic
941408272 2:165119254-165119276 CTAGGTCACATATTTATCATAGG + Intronic
942148502 2:173050693-173050715 TAATGTCACCATTTTAAAATTGG + Intronic
944847963 2:203687775-203687797 CTAGGTGTCCAATGTAAACTTGG + Intergenic
946637749 2:221748495-221748517 CTAGGTCAATATTTTAGAATAGG + Intergenic
1170680657 20:18522502-18522524 ATATTTCACCAATTTCAAATCGG - Intronic
1171806268 20:29683164-29683186 CCAGGTCAAAAATTTAAAACTGG - Intergenic
1171837790 20:30173248-30173270 CCAGGTCAAAAATTTAAAACTGG + Intergenic
1173744861 20:45428433-45428455 CTAGGATAGCAATTTGAAATAGG - Intergenic
1177440556 21:21117842-21117864 TTTGGTCACCAATTTAAACAAGG + Intronic
1180394034 22:12313016-12313038 CTAGGCCACCAATGTGAACTTGG + Intergenic
1180405713 22:12551734-12551756 CTAGGCCACCAATGTGAACTTGG - Intergenic
951394012 3:22142395-22142417 ATACGTCACCAATTTAAATTTGG - Intronic
951469724 3:23043475-23043497 CTAGGACTGCAATTTATAATGGG - Intergenic
954889499 3:53911819-53911841 CAAGTACCCCAATTTAAAATGGG + Intergenic
956542816 3:70361863-70361885 ATAGGAGACAAATTTAAAATAGG + Intergenic
956985762 3:74698271-74698293 CTAAGTCACTCACTTAAAATAGG - Intergenic
957728632 3:84102694-84102716 CTAGGCCAGCAATTTACAATTGG - Intergenic
958750743 3:98191588-98191610 ATATCTCACCAATTTTAAATTGG + Intronic
959853556 3:111120364-111120386 ATAGGTCTCCAATTTACAAAAGG - Intronic
960983963 3:123259716-123259738 ATAGGTCACAAAGTTAAAAGAGG - Intronic
963482035 3:145888180-145888202 CTTTGTCACCAATTTATAAAAGG + Intergenic
964169533 3:153753333-153753355 GTAGTTCATTAATTTAAAATAGG + Intergenic
965200896 3:165656140-165656162 CTAGGTCACCAACATCAAAGAGG + Intergenic
967641759 3:191873938-191873960 CAAGGTCAGCAAATTTAAATAGG + Intergenic
969632077 4:8344634-8344656 TTAGGTCACCATTTAAAAAGAGG + Intergenic
970951133 4:21756652-21756674 CTATGTAACCACTTTAAAAGGGG + Intronic
971752588 4:30669592-30669614 ATAGGTAATCAAGTTAAAATAGG + Intergenic
974666990 4:64975174-64975196 CTACATGACAAATTTAAAATTGG - Intergenic
974865857 4:67579837-67579859 CTATGTCACCATTTGTAAATTGG + Intronic
977728783 4:100327328-100327350 CTAGGTCAGCAAAATAAAAATGG + Intergenic
977807500 4:101319545-101319567 CTAAATCATCAATTTCAAATGGG + Intronic
980003623 4:127516606-127516628 ATATCTCACCAATTTTAAATCGG - Intergenic
980728796 4:136800848-136800870 ATAGGTCATGAATTTAAAATAGG - Intergenic
986241253 5:5961775-5961797 GGAGGTCACCAGTCTAAAATGGG + Intergenic
986862684 5:11946526-11946548 CTACATCACCAATTTCAAAAGGG - Intergenic
987885038 5:23801664-23801686 CTACTTCACCAATTTATATTGGG - Intergenic
988972869 5:36487452-36487474 CAAGGTCACCAAGTTAGGATAGG + Intergenic
989347351 5:40444686-40444708 CAAATTAACCAATTTAAAATGGG + Intergenic
990684408 5:58285198-58285220 CTAAGTCCCCTACTTAAAATTGG + Intergenic
992041689 5:72840905-72840927 CTAGTTCACCACTTGAAAATAGG - Intronic
992665708 5:79006922-79006944 GTAGGTCAGCAATTTAAAGTTGG - Intronic
993784613 5:92114037-92114059 CTATGACACCAATTTGAAAGAGG - Intergenic
996791017 5:127292907-127292929 CTAGGTCACACACTTGAAATGGG - Intronic
997157025 5:131572284-131572306 CCATCTCACCAATTTCAAATCGG + Intronic
1001331774 5:170767308-170767330 ACAGCTCACCAATTTTAAATAGG - Intronic
1002654671 5:180735255-180735277 CTAAGTAACCATTTAAAAATGGG - Intergenic
1004418963 6:15450648-15450670 CTAGGTGAACAGTTTAAAGTAGG + Intronic
1004521387 6:16364268-16364290 ATAGGGCACCATTTTAAAAATGG + Intronic
1008766516 6:54923529-54923551 CCAGGTCATAAATTTAATATGGG - Intronic
1009341904 6:62565934-62565956 TGAGGTCATCAATTTGAAATTGG - Intergenic
1014467437 6:121773453-121773475 CTAGGGCACCAAATCATAATAGG + Intergenic
1020899232 7:13983586-13983608 CTATGGCAACATTTTAAAATTGG + Intronic
1031025724 7:116677546-116677568 CTGAGTCAACATTTTAAAATTGG - Intronic
1031419002 7:121527019-121527041 ATAGGTCACTTAGTTAAAATGGG + Intergenic
1033635371 7:143207136-143207158 TTAGGTCATCAATTAAAAAGTGG - Intergenic
1034499066 7:151438532-151438554 CTAGGTGCCCATTTCAAAATGGG + Intronic
1035876949 8:3200952-3200974 GTAGGTCATCAATTAAAAGTGGG + Intronic
1042237827 8:66631923-66631945 TTAGGTCATCAACTTAAATTTGG + Exonic
1043101819 8:76056843-76056865 ATAGGTCACCATTATAACATTGG - Intergenic
1044813633 8:96088863-96088885 CCAGCTCACAAATTTAAAAGAGG + Intergenic
1045067699 8:98465805-98465827 CTCGGCCACCCATTTAAAAAAGG + Intronic
1048658195 8:136566911-136566933 CTAAGTCACCACTATAAAGTAGG + Intergenic
1050082449 9:1929181-1929203 CTACTTCACAAACTTAAAATTGG - Intergenic
1052864007 9:33454041-33454063 CCAGGTCACCCATTTAAAGATGG - Intergenic
1053295078 9:36906920-36906942 CGAGGTCACCAATTCATAAGTGG + Intronic
1056375448 9:86005194-86005216 CTGGTTCACCAGTTGAAAATTGG + Intronic
1056391663 9:86146636-86146658 ATATCTCACCAATTTCAAATTGG + Intergenic
1056983774 9:91342118-91342140 CTAGGTCAGAAGTCTAAAATGGG + Intronic
1057577899 9:96258376-96258398 CTAAGTCAACATTTTAAATTAGG - Intronic
1058812374 9:108653218-108653240 CTAGGGCTCCAATTTAAGTTTGG - Intergenic
1059802883 9:117768542-117768564 CTAGGAAACCTATTAAAAATAGG - Intergenic
1062093804 9:134692482-134692504 CTAGGTCACGAATTCTAAACCGG - Intronic
1186029515 X:5352758-5352780 CTAGGACAGCACTTTATAATAGG + Intergenic
1186076970 X:5891193-5891215 CTAGGTCACCAATTTAAAATGGG + Exonic
1187619876 X:21040323-21040345 CATGGTCATAAATTTAAAATGGG - Intergenic
1189836136 X:45025017-45025039 CTAGTTCACGAATTAAGAATTGG - Intronic
1192764866 X:74130055-74130077 CCATTTCACCAATTTCAAATCGG - Intergenic
1196634112 X:117980396-117980418 CTATTTCATTAATTTAAAATTGG - Intronic
1197949071 X:131874644-131874666 CTAGGATACCAATTTTAAGTAGG - Intergenic
1198078436 X:133216086-133216108 CTATCTCACCAATTTGAAAAAGG + Intergenic
1199383569 X:147198558-147198580 ATATGTCACCAGTTTACAATGGG - Intergenic
1200815698 Y:7529909-7529931 CTGGAACACCAAATTAAAATGGG - Intergenic
1201473744 Y:14359489-14359511 ATATCTCACCAATTTTAAATCGG - Intergenic
1201518330 Y:14842794-14842816 CCAAGTAACCAATTTAAAATGGG - Exonic
1201676384 Y:16589940-16589962 CTAGGACTCCAACTTAAAAAGGG - Intergenic
1201954350 Y:19606483-19606505 GTAGGTCACCTATTTTGAATGGG - Intergenic