ID: 1186078387

View in Genome Browser
Species Human (GRCh38)
Location X:5904837-5904859
Sequence TGTGACCTTAAAAATCGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186078387_1186078390 16 Left 1186078387 X:5904837-5904859 CCCTGTCGATTTTTAAGGTCACA 0: 1
1: 0
2: 3
3: 17
4: 109
Right 1186078390 X:5904876-5904898 AGGAAAATATAACTGTCATCAGG 0: 1
1: 1
2: 0
3: 25
4: 254
1186078387_1186078389 -4 Left 1186078387 X:5904837-5904859 CCCTGTCGATTTTTAAGGTCACA 0: 1
1: 0
2: 3
3: 17
4: 109
Right 1186078389 X:5904856-5904878 CACAGAAGCAATCAAATATGAGG 0: 1
1: 0
2: 3
3: 26
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186078387 Original CRISPR TGTGACCTTAAAAATCGACA GGG (reversed) Intronic
901091996 1:6648081-6648103 TGTGACCTTAAGAATCACCTGGG + Intronic
908358989 1:63349155-63349177 TGTGTCCTTAATAGTAGACATGG - Intergenic
910852689 1:91664289-91664311 TGTGACCTTAAGAATCGATGGGG - Intergenic
911734804 1:101325053-101325075 TGTCCCCTTAACATTCGACATGG - Intergenic
912184523 1:107258946-107258968 TGTTACCTGAAAAATCCAAAGGG + Intronic
912995419 1:114528241-114528263 TGTGGCCATAAAAAACAACAAGG - Intergenic
914038653 1:144027382-144027404 TGTAACATTAAAAATAGCCATGG - Intergenic
914150802 1:145040548-145040570 TGTAACATTAAAAATAGCCATGG + Intronic
914611339 1:149305984-149306006 TGTCACCTCAAGACTCGACAGGG - Intergenic
916154978 1:161835810-161835832 AGTGACCTTTAAAATAGAAAGGG - Intronic
918646902 1:186916217-186916239 TGTGACCTTAGGAATCGACAGGG - Intronic
921074915 1:211692728-211692750 TGTGACCTTAGGAATCGACGGGG + Intergenic
923042409 1:230328631-230328653 TGTGATGTTCAAGATCGACATGG + Intronic
924781530 1:247153358-247153380 TGAGAACTTAAACATCGAGAGGG + Intronic
924858786 1:247900158-247900180 TGTGACCTTAGGAATTGACGGGG - Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1065313546 10:24439782-24439804 AGTGTCCTTAAAAGTGGACATGG - Intronic
1071282506 10:84115328-84115350 TGTGACCTAAGGAATCGACGGGG + Intergenic
1077958268 11:7044807-7044829 TGTAATCTTAAAAATAGAGATGG - Intronic
1080058634 11:27933423-27933445 AGTGACTATAAAAATGGACAGGG - Intergenic
1080370765 11:31639495-31639517 TGTGACTTTAAAAATTAACCGGG - Intronic
1083081951 11:60103216-60103238 TGTGACCTTAGGAATCGACGGGG - Intergenic
1085367569 11:75965009-75965031 TGTCATCTTAAAATTTGACAGGG + Intronic
1090033549 11:123228642-123228664 TGTGACATTAAAAATGGATGAGG + Intergenic
1091325302 11:134682426-134682448 CGTCACCTTAAAAATCAAAACGG + Intergenic
1091814231 12:3424213-3424235 TGTGACCTTAGGAATCGATGGGG - Intronic
1091954708 12:4628800-4628822 GGTGTCCTTAAAAATAGACAAGG + Exonic
1092908434 12:13123628-13123650 TGAGACCTTAAAAAATGACTGGG - Intronic
1096208008 12:49739656-49739678 TGTGACCTTAGGAATCGACAGGG + Intronic
1096560884 12:52434917-52434939 TGTGACCTACACAATAGACACGG - Intergenic
1101028235 12:100634885-100634907 TGTGACCTTAGGAATCGACGGGG - Intergenic
1109803269 13:67404055-67404077 TGTGACCTTAAGAATCGATGGGG + Intergenic
1112865869 13:103897784-103897806 TTTGGCCTTAACAATGGACAGGG + Intergenic
1116180889 14:41532827-41532849 TGTGACATCAACAATTGACATGG - Intergenic
1126306455 15:47263737-47263759 TGTGGCCATAAAAATGAACACGG - Intronic
1127095995 15:55512862-55512884 TGTGACCTTAGGAATCGATGGGG - Intergenic
1128911109 15:71515847-71515869 TGTGCCCTGAAAAATAGCCAAGG - Intronic
1141021779 16:80503562-80503584 TGTGACCTTATAAATAAACATGG - Intergenic
1143803640 17:9407196-9407218 TGTGACTTTTAAAATAGAGACGG + Intronic
1150753775 17:67891260-67891282 TGTGTCCTTAAAAATTTACTAGG + Intronic
1154261452 18:12837133-12837155 TGTGACTTGAAAAATCGACCAGG + Intronic
1157795581 18:50571199-50571221 TGTGAAATTAAAAATCCGCAGGG - Intronic
1159931758 18:74319391-74319413 GGTTACCTTAAAAAGCAACACGG - Intronic
1163619429 19:18349484-18349506 TGTTACTTTAAAAATCAACAGGG - Intronic
1163878368 19:19895974-19895996 TGTGACCTTAGGAATCGACGGGG + Intergenic
1165638961 19:37367952-37367974 TGTGAGTTTAACAATCAACACGG - Intronic
926491164 2:13527795-13527817 TGTGATCTTAGGAATCGACGGGG - Intergenic
928230893 2:29498217-29498239 TATGACCTAAAAAATTGAAAGGG + Intronic
930236189 2:48891028-48891050 TGCCACCATAAAAATTGACAGGG - Intergenic
931537505 2:63294991-63295013 TGTGACATTAAAAACCAAAAAGG + Intronic
935721206 2:105980928-105980950 TGTGACCTTAGGAATCGATGGGG - Intergenic
935970861 2:108529601-108529623 TGTGACCTTAAGAATCGACGGGG + Intergenic
936419322 2:112348283-112348305 TGTGACCTTAAGAATCTACGGGG - Intergenic
939238760 2:139532257-139532279 TGGGACCTTAAAGCTTGACAGGG - Intergenic
940235481 2:151506979-151507001 TGTGACCTTAAAAACAGTAAAGG - Exonic
940755032 2:157672287-157672309 TCTGACCATCAAAATCGTCATGG - Intergenic
943759544 2:191593182-191593204 TGTGTGCTTAAAAATCTCCAGGG + Intergenic
944366988 2:198932594-198932616 TGTAACTATAAAAATCTACATGG + Intergenic
945749192 2:213759471-213759493 TGTGACATCAAAAATTGAGAGGG + Intronic
1172300121 20:33843857-33843879 AGTTACCTTGAAAATAGACATGG - Intronic
1172746523 20:37213817-37213839 TGTCACCTTCAACTTCGACAAGG - Exonic
1178232305 21:30800430-30800452 TGACACCTTAAAAATAGATATGG - Intergenic
1178936181 21:36863929-36863951 TGTGAACTTAAAAATATGCAGGG - Intronic
1181846907 22:25717641-25717663 TGTGTCCTTAAAAAAAGAAAAGG - Intronic
1184601640 22:45547273-45547295 TCTGACTTTCAAAATCCACAGGG + Intronic
1185233533 22:49698141-49698163 TGTGACATTAAAATTCGTCAGGG + Intergenic
949776758 3:7641833-7641855 TGTGATCTTAAGAATTTACAAGG - Intronic
951165767 3:19483759-19483781 TGTGACCTTAGGAATCGATGGGG - Intronic
951527778 3:23670329-23670351 TGTGACTGTAATAATAGACATGG - Intergenic
953291885 3:41673522-41673544 TGTGACCTGTAAAATCATCAGGG - Intronic
957406497 3:79779136-79779158 TGTGACCTTAGGAATTGATAGGG + Intergenic
958738113 3:98033468-98033490 TGTCACCTAAAAAATATACATGG + Intronic
964403390 3:156322875-156322897 TGTGGACTTAAAAACTGACATGG - Intronic
964522118 3:157581056-157581078 TGTGACCTTAGGAATCGACGAGG - Intronic
964537059 3:157734648-157734670 TGGAACCATAAAAATGGACAGGG + Intergenic
964924300 3:161937251-161937273 TGTGACCTTAGGAATCGATGGGG + Intergenic
968058123 3:195708627-195708649 TGTGCCCTCAAAAGTCTACACGG - Intergenic
968870066 4:3237375-3237397 GGTGCATTTAAAAATCGACATGG - Intronic
970003473 4:11387758-11387780 TGTGACCATAAAAACCCAAACGG - Intergenic
970004599 4:11398536-11398558 TGTGACCTCCAAAAATGACAAGG + Exonic
970613882 4:17749664-17749686 TATTACCTTAAAAATAAACATGG + Intronic
971899477 4:32640566-32640588 TGTGACCTCAAAGATCAACAAGG + Intergenic
972060326 4:34861758-34861780 TTTTACTTTATAAATCGACAAGG + Intergenic
975990638 4:80256723-80256745 TATGACCTATAAAATAGACAAGG + Intergenic
978767521 4:112419574-112419596 AGTAACTTTAAAAATTGACAAGG + Intronic
980780430 4:137485185-137485207 TGTGACCTTAGGAATCGAAGGGG + Intergenic
983898250 4:173104404-173104426 TGTGACCTTAGGAATCGATGGGG + Intergenic
983920272 4:173336425-173336447 TGTGACCTCAAAAATTTAGAGGG + Intergenic
998734831 5:145125096-145125118 TGTTGCCTTAAAAATGAACAAGG - Intergenic
1003438670 6:6119883-6119905 TGTAACCTTCAAAATTGTCAAGG - Intergenic
1010111711 6:72243466-72243488 TGTTATTTTAAAAATCTACATGG - Intronic
1014546615 6:122743349-122743371 TGTGACCTTAGGAATCGACGGGG - Intergenic
1014851577 6:126346166-126346188 TTTGAGCTTAAAAATCCACTTGG + Intronic
1014929432 6:127316983-127317005 TGTGAGCTAAAAAAAAGACAAGG - Intronic
1015592422 6:134834818-134834840 TTTGAGTTTAAAAATCAACAGGG + Intergenic
1015656892 6:135528778-135528800 TGTGAACATAAAAATCTATATGG + Intergenic
1015729100 6:136330352-136330374 TGTGACCTAAAAAAAGGAAAAGG - Intergenic
1016669738 6:146689802-146689824 TGGAAACTTAAAACTCGACAGGG + Intronic
1017750153 6:157483864-157483886 TGTGTAGTTAAAAATAGACATGG + Intronic
1023320803 7:38995567-38995589 TGGGACCTTATAATTCTACAAGG - Intronic
1029486369 7:100844747-100844769 TGTGACCTTAGGAATCAACGGGG + Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1033996041 7:147349429-147349451 TTTGAACTTAAAAATTCACAAGG - Intronic
1035815181 8:2531332-2531354 TTTGACCTTTAAAATAGAGAAGG - Intergenic
1036508916 8:9382472-9382494 TGTGACATTTAAAATCAAGAAGG + Intergenic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1039252978 8:35687146-35687168 TGTTACCTTAAAAATAGGCCGGG + Intronic
1039367727 8:36948913-36948935 TGTAAACTTAAAAATCGTTAAGG + Intergenic
1039876721 8:41592811-41592833 TGTGACCTTAGGAATCGATGGGG - Intronic
1041515744 8:58697010-58697032 TGTGACCTTAGGAATCAACGGGG + Intergenic
1045696189 8:104811175-104811197 TTTTACCTCAAAAATCAACAAGG - Intronic
1047042013 8:121006900-121006922 TGTGGCATTAACAATCCACATGG + Intergenic
1051543836 9:18251823-18251845 TGAGAAATTAAAAATTGACAAGG + Intergenic
1058961686 9:109997991-109998013 TGAGATTTTAAAAATCCACAGGG + Intronic
1059840354 9:118208640-118208662 TCTTACCTTAAGAATCTACATGG - Intergenic
1060037129 9:120265053-120265075 TGTGACCACAAAAATTGTCAGGG + Intergenic
1061314271 9:129784724-129784746 TGTGTCCATAAAAATGGATAGGG + Intergenic
1185910248 X:3974329-3974351 TGTGACCTTAGGAATCGATGGGG + Intergenic
1186078387 X:5904837-5904859 TGTGACCTTAAAAATCGACAGGG - Intronic
1186532149 X:10307908-10307930 AGTGATCTTAACAATCAACAGGG - Intergenic
1189994425 X:46625403-46625425 TGGGCCCTTAAAAGTGGACAAGG + Intronic
1191639500 X:63414873-63414895 TGTGACCTTAGGAATCGATGGGG + Intergenic
1194132309 X:90096092-90096114 TGTACCCTAAAAAATCCACAGGG + Intergenic
1194307370 X:92264974-92264996 TATGACGTTAAAAATCTGCAAGG + Intronic
1194384666 X:93237795-93237817 TGTGACCTTAGGAATCGATGGGG + Intergenic
1195588657 X:106598401-106598423 TGTGCCCTTAAACATGGACAAGG - Intergenic
1199365488 X:146976666-146976688 TGTGCCCCTAAAAAGAGACAGGG - Intergenic
1200393795 X:155970784-155970806 TGTGACCTTAGAAATCGATGGGG - Intergenic
1200478107 Y:3666180-3666202 TGTACCCTAAAAAATCCACAGGG + Intergenic