ID: 1186079878

View in Genome Browser
Species Human (GRCh38)
Location X:5919502-5919524
Sequence GCCCAGTCCCTAACCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186079878_1186079886 8 Left 1186079878 X:5919502-5919524 CCAGTTTTGGTTAGGGACTGGGC 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1186079886 X:5919533-5919555 GGTGAGTGGTGGGCAAGCGAGGG 0: 1
1: 2
2: 3
3: 39
4: 369
1186079878_1186079881 -6 Left 1186079878 X:5919502-5919524 CCAGTTTTGGTTAGGGACTGGGC 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1186079881 X:5919519-5919541 CTGGGCCAGCAGGAGGTGAGTGG 0: 1
1: 0
2: 11
3: 101
4: 677
1186079878_1186079883 -2 Left 1186079878 X:5919502-5919524 CCAGTTTTGGTTAGGGACTGGGC 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1186079883 X:5919523-5919545 GCCAGCAGGAGGTGAGTGGTGGG 0: 1
1: 9
2: 195
3: 631
4: 1329
1186079878_1186079885 7 Left 1186079878 X:5919502-5919524 CCAGTTTTGGTTAGGGACTGGGC 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1186079885 X:5919532-5919554 AGGTGAGTGGTGGGCAAGCGAGG 0: 1
1: 3
2: 9
3: 39
4: 307
1186079878_1186079882 -3 Left 1186079878 X:5919502-5919524 CCAGTTTTGGTTAGGGACTGGGC 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1186079882 X:5919522-5919544 GGCCAGCAGGAGGTGAGTGGTGG 0: 1
1: 8
2: 154
3: 424
4: 1169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186079878 Original CRISPR GCCCAGTCCCTAACCAAAAC TGG (reversed) Intronic
901353290 1:8618507-8618529 GCCCACCCCCCAACCAAAAAAGG + Intronic
901404710 1:9038413-9038435 GCCCAGTACGTACCCAAAGCTGG - Exonic
903565111 1:24259308-24259330 GCCCTGTCGCTAATCAATACTGG + Intergenic
907280549 1:53344315-53344337 ACCCAGCCCCTCACCAGAACAGG + Intergenic
914807401 1:151001711-151001733 GCCCAGTCACTCACCAAGATGGG + Exonic
921709091 1:218355476-218355498 GCCAAGTTGCTAACCAAAACAGG - Intronic
922537164 1:226389988-226390010 GCCCATCCCCTAACTAAAAATGG + Intronic
924383526 1:243483590-243483612 GCCCAGCCCCTCACCAGAAGAGG + Intronic
1062921497 10:1283785-1283807 TCCCAGTCCCTACCCAGAAGTGG - Intronic
1070634290 10:78111494-78111516 GACCAGTCACTAGCCAGAACGGG - Intergenic
1070715667 10:78719308-78719330 GCCCAGTCCCTTACCCACTCCGG - Intergenic
1070867746 10:79717485-79717507 GCCCATTCCTAAAACAAAACTGG - Intergenic
1071634659 10:87239686-87239708 GCCCATTCCTAAAACAAAACTGG - Intergenic
1071660585 10:87498314-87498336 GCCCATTCCTAAAACAAAACTGG + Intergenic
1075591209 10:123692935-123692957 GCCCAGTCCCTGAATAAAACTGG - Exonic
1076226562 10:128781093-128781115 GCACAGGCCCTAACCAGATCGGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1080226789 11:29970854-29970876 GCTCAGCCCCTTACCAAATCAGG + Intergenic
1081502366 11:43679592-43679614 CCCCACTCCCCAACCAAAAAAGG + Intronic
1081730669 11:45369731-45369753 GCCCAGTCCCTAAAGAAAAATGG - Intergenic
1084518454 11:69648827-69648849 GCCCAGGCCAGAGCCAAAACGGG - Intronic
1085840836 11:80010044-80010066 GCCCAGTGACTAGCCAACACAGG + Intergenic
1086483897 11:87276347-87276369 GTCAAGTACTTAACCAAAACTGG + Intronic
1088645704 11:111914414-111914436 TCCCAGCCCCTACCCAAAAAGGG - Intronic
1097132710 12:56824640-56824662 GTCCAGGCCGAAACCAAAACTGG - Intergenic
1098190373 12:67941759-67941781 GACCTGTCCCTAACCTAAGCGGG - Intergenic
1100636158 12:96436538-96436560 GCCCAGTCTCCTACCAATACTGG + Intergenic
1104640372 12:130463218-130463240 GCCCAGTCCCAAACCCAGACAGG - Intronic
1114092688 14:19303180-19303202 TCCCAGTCCCTACCCAACCCTGG + Intergenic
1116849966 14:49898855-49898877 GCACAGTCCCTATAAAAAACAGG - Intergenic
1117176482 14:53152180-53152202 GACCAGTCCCAAACCCACACCGG + Intronic
1120183546 14:81369235-81369257 GCCAGGACCCCAACCAAAACAGG + Intronic
1120327889 14:83052622-83052644 TCCCAGTCCTTGACCATAACAGG + Intergenic
1124507555 15:30291522-30291544 GCACTGTCCCTGACAAAAACGGG + Intergenic
1124736000 15:32247136-32247158 GCACTGTCCCTGACAAAAACGGG - Intergenic
1126118187 15:45227808-45227830 GGCCAGTTCCTAACCAGTACTGG - Intergenic
1134487482 16:14669977-14669999 CCCCAGTCCCTGAGCAAATCTGG - Intergenic
1136708863 16:32216364-32216386 GCCAAATCCCTAACGGAAACTGG - Intergenic
1136759045 16:32713044-32713066 GCCAAATCCCTAACGGAAACTGG + Intergenic
1136809062 16:33157342-33157364 GCCAAATCCCTAACGGAAACTGG - Intergenic
1136815538 16:33267422-33267444 GCCAAATCCCTAACGGAAACTGG - Intronic
1138177380 16:54912872-54912894 GCCCAGTCCCTAATTAAATCTGG - Intergenic
1142375898 16:89707008-89707030 GCCCAGCCCCAAACCAAGCCTGG - Intergenic
1203061203 16_KI270728v1_random:973358-973380 GCCAAATCCCTAACGGAAACTGG + Intergenic
1146273574 17:31500074-31500096 GCCCATTTCCTAAACAAAAAGGG - Intronic
1151077543 17:71290949-71290971 GGCCAGCCCCTGACCAGAACTGG + Intergenic
1158384279 18:56971603-56971625 CCCCAGACCCTAAACAAATCTGG - Intronic
1158557166 18:58485017-58485039 GCCCAGTACAAAACGAAAACAGG + Intronic
1167302196 19:48684621-48684643 GCCCTGTCCCTCACCAGAAGGGG + Intergenic
926241902 2:11094860-11094882 GCCCAGGCCCTAACTGTAACTGG + Intergenic
936260055 2:110951100-110951122 CCCCATTCCCTAACCAGAAGTGG - Intronic
1169614969 20:7430964-7430986 GCCCAGTCCATGACAAAAAGTGG + Intergenic
1171213167 20:23332619-23332641 GACCAGTTCCAAACCAAAAAGGG - Intergenic
1172852855 20:37979098-37979120 GCCCAGCCCCAAACCAAACTTGG - Intergenic
1173673032 20:44810811-44810833 GTCCAGTCCCTCACCCAGACAGG + Intergenic
1175466337 20:59193025-59193047 GCACAGTCCCCACCCAAGACAGG + Exonic
1180488041 22:15819386-15819408 TCCCAGTCCCTACCCAACCCTGG - Intergenic
962409173 3:135126525-135126547 GCCCAGTACCTAATAAGAACTGG + Intronic
963313333 3:143732079-143732101 TCCTAGTCACTAACCAACACAGG - Intronic
969247172 4:5943040-5943062 GCCTAGTGCCTAACCAAGCCTGG - Intronic
970820278 4:20204285-20204307 GGACTGTCCCTACCCAAAACTGG - Intergenic
972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG + Intronic
978642612 4:110889389-110889411 CCCCAGTACCTAAACAAAATGGG - Intergenic
978836572 4:113157601-113157623 GCCCTGCCCCTAACCAAAAAAGG + Intronic
979465224 4:121029592-121029614 GACAAGTCCCTTACTAAAACTGG - Intergenic
986312086 5:6558234-6558256 GCCCAGGCCTTAAAAAAAACAGG + Intergenic
993848809 5:92979820-92979842 GCCCAGACCCTCACAAAAGCTGG + Intergenic
1006878653 6:37320200-37320222 GCACAGTCCCTAACCTTGACAGG - Intronic
1010264929 6:73855560-73855582 ACTTATTCCCTAACCAAAACAGG - Intergenic
1016032819 6:139355786-139355808 GACCTGTCCCAAACCAAAGCAGG + Intergenic
1023842957 7:44107068-44107090 GCCCTCTCCCTACCCAAAAGAGG - Intronic
1024381699 7:48704150-48704172 GCAGATTCCCTAACCACAACTGG - Intergenic
1033065288 7:138147643-138147665 GCCCAGTTCCTAACCAATACCGG + Intergenic
1033677874 7:143561652-143561674 ACCCTGTCTCTACCCAAAACAGG + Intergenic
1034359435 7:150481041-150481063 TCCCACTCTCTAACCAAAAGAGG - Intergenic
1044031983 8:87249673-87249695 GCCTAATTCCTAACCAAATCAGG + Intronic
1045698132 8:104834527-104834549 GCGCAGTTCCTAACCACTACTGG - Intronic
1050327223 9:4509274-4509296 GCCAGGTCCCTAACCAATACAGG - Intronic
1055324958 9:75119417-75119439 TCCCAATCCCTCACCAACACAGG - Intronic
1058429765 9:104907742-104907764 GCCCAGTCCTTAGCTAAAGCTGG - Intronic
1062500761 9:136851084-136851106 CCCCAGACCCTAACTAAAGCAGG + Intronic
1186079878 X:5919502-5919524 GCCCAGTCCCTAACCAAAACTGG - Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic