ID: 1186081043 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:5932136-5932158 |
| Sequence | CTGGGGGTGTGGAGGGGAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2041 | |||
| Summary | {0: 1, 1: 2, 2: 22, 3: 242, 4: 1774} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186081043_1186081053 | -6 | Left | 1186081043 | X:5932136-5932158 | CCCCTTCCCCTCCACACCCCCAG | 0: 1 1: 2 2: 22 3: 242 4: 1774 |
||
| Right | 1186081053 | X:5932153-5932175 | CCCCAGGAATGAAGCTAAAGAGG | 0: 1 1: 0 2: 0 3: 20 4: 185 |
||||
| 1186081043_1186081056 | 14 | Left | 1186081043 | X:5932136-5932158 | CCCCTTCCCCTCCACACCCCCAG | 0: 1 1: 2 2: 22 3: 242 4: 1774 |
||
| Right | 1186081056 | X:5932173-5932195 | AGGCTGTTTCTTCCTAATGCTGG | 0: 1 1: 0 2: 1 3: 12 4: 152 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186081043 | Original CRISPR | CTGGGGGTGTGGAGGGGAAG GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||