ID: 1186081043

View in Genome Browser
Species Human (GRCh38)
Location X:5932136-5932158
Sequence CTGGGGGTGTGGAGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2041
Summary {0: 1, 1: 2, 2: 22, 3: 242, 4: 1774}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186081043_1186081053 -6 Left 1186081043 X:5932136-5932158 CCCCTTCCCCTCCACACCCCCAG 0: 1
1: 2
2: 22
3: 242
4: 1774
Right 1186081053 X:5932153-5932175 CCCCAGGAATGAAGCTAAAGAGG 0: 1
1: 0
2: 0
3: 20
4: 185
1186081043_1186081056 14 Left 1186081043 X:5932136-5932158 CCCCTTCCCCTCCACACCCCCAG 0: 1
1: 2
2: 22
3: 242
4: 1774
Right 1186081056 X:5932173-5932195 AGGCTGTTTCTTCCTAATGCTGG 0: 1
1: 0
2: 1
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186081043 Original CRISPR CTGGGGGTGTGGAGGGGAAG GGG (reversed) Intronic
Too many off-targets to display for this crispr