ID: 1186081596

View in Genome Browser
Species Human (GRCh38)
Location X:5939177-5939199
Sequence GTACCTCAGCCATAGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186081590_1186081596 21 Left 1186081590 X:5939133-5939155 CCAGCAGACATTCCATCTGCATG 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1186081596 X:5939177-5939199 GTACCTCAGCCATAGAGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1186081589_1186081596 22 Left 1186081589 X:5939132-5939154 CCCAGCAGACATTCCATCTGCAT 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1186081596 X:5939177-5939199 GTACCTCAGCCATAGAGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1186081594_1186081596 9 Left 1186081594 X:5939145-5939167 CCATCTGCATGGAGAAGGGAACA 0: 1
1: 0
2: 1
3: 34
4: 275
Right 1186081596 X:5939177-5939199 GTACCTCAGCCATAGAGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186081596 Original CRISPR GTACCTCAGCCATAGAGCTC TGG Intronic
900485428 1:2920512-2920534 GGACCTCAGCCAGTGGGCTCTGG - Intergenic
904492205 1:30868099-30868121 GTACCAAAGCCATAGGCCTCGGG + Intergenic
904788893 1:33002904-33002926 GTACCTCACCCTTAGAACTGGGG - Intergenic
922398023 1:225222850-225222872 GTACACTAGACATAGAGCTCTGG + Intronic
1062905022 10:1174040-1174062 GTACCTCAGGGATAGAGCTGTGG + Intergenic
1063247354 10:4235713-4235735 CTACCTCAGTCAGAGAGCACTGG + Intergenic
1069837228 10:71317095-71317117 AGACCTCAGCCTCAGAGCTCTGG + Intergenic
1074859524 10:117499745-117499767 GTAGCTCAGACACAGGGCTCTGG + Intergenic
1076055280 10:127367712-127367734 GGTCCATAGCCATAGAGCTCCGG + Intronic
1077363309 11:2150788-2150810 GTCTCTAAGCCATAGAGCCCCGG - Intronic
1085216167 11:74834778-74834800 ACACCTCAGCCACAGACCTCCGG + Intronic
1107834559 13:44403097-44403119 GAGCCTCAGCCTGAGAGCTCAGG - Intergenic
1111711226 13:91816771-91816793 GTACCAAAGCCATAAATCTCAGG - Intronic
1112195931 13:97226243-97226265 GTCCATCAGCCTCAGAGCTCAGG - Intronic
1113153749 13:107293727-107293749 GAACCTCAGGAATAGAGCCCAGG + Intronic
1115327768 14:32161451-32161473 GTATCTCTGCCATAATGCTCAGG + Intergenic
1116393031 14:44416312-44416334 GTACACTAGACATAGAGCTCTGG + Intergenic
1117646367 14:57857635-57857657 CTATCTCACCCATAGAGCTTGGG - Intronic
1119084174 14:71724714-71724736 GTGCCTCAACCAGAGACCTCCGG + Exonic
1121038915 14:90729094-90729116 GGACCTCAGCCAGAGGCCTCTGG + Intronic
1127608769 15:60616755-60616777 GTACCTCAACCACAGAACGCAGG - Intronic
1133164430 16:3936420-3936442 GTCCCCCAGGCATGGAGCTCAGG - Intergenic
1134351491 16:13441809-13441831 GCACCCCAGCCTCAGAGCTCTGG + Intergenic
1137055344 16:35743417-35743439 GCACCTAAGCCAAAGAGGTCAGG - Intergenic
1137801962 16:51269699-51269721 TTACCTCACCTATTGAGCTCAGG - Intergenic
1147418398 17:40309705-40309727 CTTCCTCACCCAAAGAGCTCAGG + Intronic
1148335683 17:46839449-46839471 GTGCCACAGCCATACAGCTTTGG - Intronic
1152698985 17:81810048-81810070 GTAACTGAGCCACAGAGCTGGGG + Intronic
1158825322 18:61212156-61212178 AAACCTCCGCCAAAGAGCTCAGG - Intergenic
925255564 2:2483910-2483932 CTCCCTCAGCCATTGTGCTCAGG + Intergenic
928124638 2:28607050-28607072 GTCCCTCCTCCATACAGCTCTGG - Intronic
929596307 2:43178521-43178543 GTACCTCTGGCAAGGAGCTCTGG + Intergenic
933933773 2:87182635-87182657 GTACCCTAGGCATAGAGCTAGGG + Intergenic
936359337 2:111782809-111782831 GTACCCTAGGCATAGAGCTAGGG - Intronic
938134044 2:128739206-128739228 GTCCCTCAGCCTGAGATCTCAGG - Intergenic
938162398 2:128997552-128997574 GGACCTGAGCCAGAAAGCTCAGG + Intergenic
938224599 2:129605087-129605109 GTAACCCAGCCTGAGAGCTCAGG + Intergenic
945277410 2:208001718-208001740 GTGCTTCAGCAATAGAGCTATGG + Exonic
947556327 2:231096517-231096539 GTACATTAGACATAGAGCTCTGG - Intronic
948147903 2:235722198-235722220 GTACCTCAGTCCTAGGGCTGTGG + Intronic
1175762681 20:61572012-61572034 GGACCTCTGCCTTAGAGCCCAGG + Intronic
1176263673 20:64197476-64197498 CTACCTCACGCATAGAGCCCTGG + Intronic
1179243642 21:39612258-39612280 GTACCACAGCCATAGTGCGGGGG - Intronic
1181531150 22:23518230-23518252 GTGACTCAGCCACAGAGGTCAGG + Intergenic
949421900 3:3874680-3874702 ATACCTGGGACATAGAGCTCAGG + Intronic
951224841 3:20108996-20109018 GGACCTCTGCCATAGAGCCTAGG + Intronic
953741491 3:45542785-45542807 CTACATCAGGCATAGTGCTCTGG + Intronic
956176857 3:66481104-66481126 GGACCTCAGCCACAGAGGACTGG - Intronic
959285856 3:104409942-104409964 GTATCTCAGCCATAAAGCCTTGG - Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
984329382 4:178296065-178296087 GTACCTCACCCATAGTGCATTGG + Intergenic
985578794 5:685909-685931 GATACTCAGCCATAGTGCTCTGG - Intronic
990217796 5:53553100-53553122 CTACCCCAGCTTTAGAGCTCTGG + Intergenic
995469142 5:112481949-112481971 TTCCCTCAGCCATAAAGCACAGG - Intergenic
997507080 5:134426153-134426175 GAACATCAGCCACAGAGCTGGGG - Intergenic
997796345 5:136815290-136815312 GCTCCTCAGCCATAGAGCAAAGG + Intergenic
998513100 5:142729991-142730013 GTACCTATGCCATGGATCTCAGG + Intergenic
1002347820 5:178560288-178560310 GCACGTCTGACATAGAGCTCTGG + Intronic
1005810068 6:29508599-29508621 GCTCCTGAGCCAGAGAGCTCAGG - Intergenic
1006548221 6:34797259-34797281 GAACCTCAGCGATAGAGACCTGG + Intronic
1007823248 6:44577785-44577807 GCACTTCAGCCATGGAGCTCTGG + Intergenic
1010309175 6:74363325-74363347 GAACCTAAGCCATAGACTTCAGG + Intergenic
1014490667 6:122057747-122057769 GTACCTGAACCATACAGCACAGG - Intergenic
1017375747 6:153766087-153766109 ATACCTGAGACATAGACCTCTGG + Intergenic
1021147595 7:17107842-17107864 GTACCCAAGCCAAAGAGATCAGG - Intergenic
1023131586 7:37008703-37008725 GATTCTCAGACATAGAGCTCTGG + Intronic
1024506542 7:50167073-50167095 GAACCTCAGCCAAGGAGCTGAGG + Intergenic
1026406256 7:70069158-70069180 GTACCTCAGTAATAGGGTTCAGG + Intronic
1034865801 7:154640696-154640718 GATCCTCAGACTTAGAGCTCCGG - Intronic
1042955796 8:74249466-74249488 TGACCACAGCCATAGTGCTCTGG + Intronic
1044645140 8:94433046-94433068 ATACCTTAGCCCTAGACCTCAGG + Intronic
1046027472 8:108742700-108742722 GTAGCTGAGCAAGAGAGCTCAGG - Intronic
1048016292 8:130500397-130500419 GTTCTTCAGCCATTGACCTCTGG - Intergenic
1051055158 9:12976907-12976929 TTACCACTGCCTTAGAGCTCAGG - Intergenic
1057081168 9:92175743-92175765 GTACCTCAGTGGTGGAGCTCTGG + Intergenic
1059506876 9:114807225-114807247 GGAACTCGGCCTTAGAGCTCAGG + Intergenic
1061249323 9:129417223-129417245 GTGACTCAGCCACAGAGGTCAGG - Intergenic
1186081596 X:5939177-5939199 GTACCTCAGCCATAGAGCTCTGG + Intronic
1190585504 X:51936107-51936129 TTTCCTCAGCCCTAGAGCTGAGG + Intergenic
1192564678 X:72153841-72153863 GAACCTCAGCCTTAGAGGCCTGG - Intergenic
1201513429 Y:14790606-14790628 GTACCTCAGCCACAGTATTCTGG - Intronic