ID: 1186082233

View in Genome Browser
Species Human (GRCh38)
Location X:5945600-5945622
Sequence GGATTCCCAGGAAAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186082228_1186082233 7 Left 1186082228 X:5945570-5945592 CCATGGCGCTTGTCTGGAATCAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1186082233 X:5945600-5945622 GGATTCCCAGGAAAGCCAGGAGG 0: 1
1: 0
2: 3
3: 32
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186082233 Original CRISPR GGATTCCCAGGAAAGCCAGG AGG Intronic
900079150 1:842631-842653 GGACTCCCTGGTGAGCCAGGTGG - Intergenic
900501261 1:3005841-3005863 TGATTCTCAGGAGAGCCTGGAGG - Intergenic
902112114 1:14090218-14090240 GGAGTCCCAGAAAAGCCAGAGGG - Intergenic
902226147 1:14997647-14997669 GGATTCTCAGTAAATCCATGCGG + Intronic
902511331 1:16968400-16968422 GGATTCCCTGCAGAGACAGGTGG + Exonic
902656726 1:17874194-17874216 GGAGGCCCAGGAAAGCCCGGTGG - Intergenic
902728993 1:18356459-18356481 GTATTCACAGGAGATCCAGGTGG - Intronic
903019073 1:20381031-20381053 GGATTCCCTGGCCAGCCATGGGG + Intergenic
903452816 1:23466123-23466145 GGATTCCCAGGACTGAGAGGTGG + Intronic
903625391 1:24726644-24726666 GGATTCCAAGGATAGCAAGAGGG - Intergenic
903641873 1:24865690-24865712 GGAATCCCAGCCAAGGCAGGAGG + Intergenic
904360385 1:29967416-29967438 GGACTGCCAGGAGAGCCAGAAGG + Intergenic
904382519 1:30120933-30120955 GGATTTCAAGGCAGGCCAGGAGG + Intergenic
904701649 1:32361758-32361780 CGAGTCCCAGGACAGCCCGGAGG - Exonic
905169185 1:36099382-36099404 GGTTTTCCTGGGAAGCCAGGGGG + Exonic
908657694 1:66405348-66405370 GCATTCCCAAGACAGCCAGAAGG - Intergenic
911340320 1:96628284-96628306 GGGTACTCAGGAAAGCCAGTGGG + Intergenic
911881645 1:103246831-103246853 GCTATCCCAGGAAAGCCATGAGG + Intergenic
912066172 1:105746386-105746408 GGAAAACCAGGAAAGCTAGGTGG + Intergenic
913257992 1:116972673-116972695 TGCTTCCCAGGAAACCCAAGGGG + Intronic
913599180 1:120406271-120406293 GGACTCCTGGGAAAGCCAGCAGG - Intergenic
914088197 1:144473349-144473371 GGACTCCTGGGAAAGCCAGCAGG + Intergenic
914310414 1:146460861-146460883 GGACTCCTGGGAAAGCCAGCAGG - Intergenic
914314770 1:146499894-146499916 GGACTCCTGGGAAAGCCAGCAGG + Intergenic
914499581 1:148233494-148233516 GGACTCCTGGGAAAGCCAGCAGG - Intergenic
914591695 1:149112281-149112303 GGACTCCTGGGAAAGCCAGCAGG + Intergenic
915231958 1:154452286-154452308 GGAGTCCCAGCAAAGCCATGTGG + Intronic
915346780 1:155201524-155201546 GGTTGCCCAGGAAACCCAGGCGG + Exonic
917235162 1:172884003-172884025 GCATACCCAGGAATGGCAGGAGG - Intergenic
917296407 1:173523823-173523845 GGAGGCCCAGGAAAGCCTAGAGG - Intronic
919086585 1:192928096-192928118 GGTTTCCCAGGATATCCAGGAGG - Intergenic
920030694 1:203035758-203035780 GGAGCCCCAGGACAGCCACGTGG - Intronic
920347995 1:205318954-205318976 AGATTCAGAGGAAAGCCAGCTGG - Intronic
920648854 1:207822129-207822151 GGATTTCCAGAAAAGTCAGTGGG - Intergenic
923298202 1:232615488-232615510 TGAATCACAGGAAAGCCAGAGGG + Intergenic
923318633 1:232805986-232806008 GGCTTCCCAGGTCAGTCAGGCGG - Exonic
924027208 1:239846809-239846831 GAATTCCCAGGAAAGATAAGCGG + Intronic
1063619283 10:7630989-7631011 GGTTACCCAGGAACCCCAGGTGG + Intronic
1064831981 10:19479298-19479320 GGAGCCCCAGGAGAGCCAGATGG + Intronic
1065794594 10:29294194-29294216 AGAATCCCAGGGAAGGCAGGTGG + Intronic
1067975231 10:51017170-51017192 GGATTCCCAGGAAGTGCTGGGGG - Intronic
1069633500 10:69911840-69911862 GGACTCCCAATAAAGCCTGGAGG + Intronic
1069723591 10:70564134-70564156 GGATGCTCAGGGAGGCCAGGAGG + Intronic
1069899216 10:71697290-71697312 GGATTTCCTGGAAAGTGAGGAGG - Intronic
1070679120 10:78436410-78436432 CGTTTCCCAGGGAGGCCAGGAGG - Intergenic
1071334999 10:84593461-84593483 GAGTTCCTAGGAAAGTCAGGTGG + Intergenic
1072268700 10:93754891-93754913 GGAGGCCCAGGGAAGCCAGGAGG - Intergenic
1072700745 10:97639770-97639792 GGCTTCCTAGGAAAACCTGGAGG + Intronic
1072758923 10:98039978-98040000 GGAAACCCAGGAAAGCCAGCTGG + Intergenic
1073762285 10:106642857-106642879 GTATTCTCAGAGAAGCCAGGAGG + Intronic
1074165796 10:110872457-110872479 GGATTCCCAGGGAGGGCAGGGGG - Intronic
1074424161 10:113336408-113336430 GGATACCAAGGAAGGACAGGTGG - Intergenic
1074559768 10:114524938-114524960 GGAGTCCCAGGGAGGCCTGGCGG - Intronic
1075559625 10:123459131-123459153 TGGTTTCCAGGGAAGCCAGGGGG - Intergenic
1076075627 10:127531710-127531732 AGAATCCCAGGAATGCCAGATGG - Intergenic
1077446021 11:2591272-2591294 GGATGCCCAGGAAAGCCCCAAGG - Intronic
1078011472 11:7576154-7576176 GGAGTTCCAGGAAACCCCGGAGG + Intronic
1079967845 11:27000871-27000893 GGACTATCAGGAAAGCAAGGTGG - Intergenic
1080389628 11:31832971-31832993 GGAGTCCCTAGAAAGGCAGGAGG + Intronic
1081821944 11:46007225-46007247 GGATTCCTTGAAAAGACAGGGGG - Intronic
1082726475 11:56743082-56743104 GGATTCTCAGGATAGCCAGGAGG + Exonic
1083398408 11:62406963-62406985 GGATTCCCAGGGTGGCCAGGAGG + Intronic
1084267094 11:68010657-68010679 GGAATCCCAGGAAAAGGAGGCGG - Intronic
1084893734 11:72250469-72250491 TGATTCCCATGAAAGGAAGGTGG - Intergenic
1085253508 11:75159290-75159312 GGGGTCCCAGGTAGGCCAGGTGG - Intronic
1089292258 11:117444379-117444401 GGGGTCCCAGGAAAGCCCTGAGG + Intronic
1089517838 11:119045011-119045033 GGAAGCCAAGGAAACCCAGGGGG + Exonic
1089590257 11:119535567-119535589 GGATTCCCAGGGGATGCAGGTGG + Intergenic
1089666091 11:120020651-120020673 TGAGTACCAGGGAAGCCAGGGGG + Intergenic
1089690933 11:120186324-120186346 GGGTGCCCAGCAAAGCAAGGGGG + Intergenic
1089943056 11:122439755-122439777 GGTTTCCGAGGAAAGCCAGAAGG + Intergenic
1090400088 11:126443465-126443487 GGACACTCAGGAAAGGCAGGAGG + Intronic
1091279240 11:134372751-134372773 GGCCTGCCAGGAAAGCCACGTGG + Intronic
1091795896 12:3297425-3297447 TGATTCTCAGGAATGCCAGTGGG - Intergenic
1095247393 12:39938954-39938976 GATTTCTCAGGAAAGCCTGGAGG + Intronic
1099158392 12:79208669-79208691 GGATTCTTAGGAAAGGCAGCTGG + Intronic
1099661831 12:85574059-85574081 GGGGTCCCAAGAAAACCAGGTGG - Intergenic
1100250576 12:92818237-92818259 GGAATCTAAGGAAAGCCTGGTGG - Intronic
1100626177 12:96334927-96334949 AGATTTCCAGTAAACCCAGGCGG - Intronic
1100712896 12:97276324-97276346 GGATGCCGAGGAAAGCCCAGAGG - Intergenic
1100778204 12:97995481-97995503 GCATTCCCCTGAGAGCCAGGTGG + Intergenic
1101122027 12:101592208-101592230 GTACTCTCAGGAAAGACAGGGGG - Intronic
1101587330 12:106096221-106096243 TGAATTCCAGGAAACCCAGGAGG + Intronic
1101711308 12:107269308-107269330 GCATGCCTAGGTAAGCCAGGTGG - Intergenic
1102234282 12:111284464-111284486 TGATTCCCAGGGAGGCCAGAAGG - Intronic
1102624056 12:114220416-114220438 GGATTCCAAGGAAAGAGAGTAGG - Intergenic
1103992740 12:124810131-124810153 AGCTACCCAGGAAACCCAGGAGG + Intronic
1104628976 12:130383397-130383419 CGATCCCCAGGAAATCCAAGTGG - Intergenic
1104765201 12:131325877-131325899 GGAACCACAGGAAACCCAGGAGG - Intergenic
1105779935 13:23696740-23696762 GGAATCACAGGAAAGCCAGCCGG + Intergenic
1106076568 13:26465762-26465784 GGAGTCACAGGAAAGCAGGGTGG + Intergenic
1106224016 13:27771566-27771588 CTATACCCAGGAAAGCAAGGTGG - Intergenic
1107330332 13:39292844-39292866 GGGTTTCCATTAAAGCCAGGGGG + Intergenic
1109024856 13:57143716-57143738 ATATTCCCATTAAAGCCAGGAGG - Exonic
1109025843 13:57150286-57150308 ATATTCCCATTAAAGCCAGGAGG - Exonic
1109026833 13:57156859-57156881 ATATTCCCATTAAAGCCAGGAGG - Exonic
1109027825 13:57163430-57163452 ATATTCCCATTAAAGCCAGGAGG - Exonic
1109028811 13:57169995-57170017 ATATTCCCATTAAAGCCAGGAGG - Exonic
1110541640 13:76713024-76713046 GGAGGCCCAGGAAAGCCAGTAGG + Intergenic
1110705378 13:78597735-78597757 AGCTTCTCAGGAAATCCAGGCGG - Intergenic
1113054845 13:106257080-106257102 CCATTCCCAGAGAAGCCAGGGGG + Intergenic
1113394714 13:109936418-109936440 AGAGCCCCAGGAATGCCAGGTGG + Intergenic
1113596321 13:111536718-111536740 GAATTCCCAGTCAAGCCAAGTGG + Intergenic
1115606210 14:35004895-35004917 GAATTTCAAGGAAAGCCATGAGG - Intronic
1115905435 14:38197999-38198021 GTATTCCCAGGAAAGGAAGAGGG - Intergenic
1118443312 14:65830994-65831016 GAAATCCCAGGGAACCCAGGTGG + Intergenic
1118751849 14:68813500-68813522 GGACTCCCAGGAGAGGCAGGTGG + Intergenic
1119347428 14:73937979-73938001 GGATCCCCATAAAAGCCTGGAGG - Exonic
1122264900 14:100541976-100541998 GGTTTCCCAGGTGACCCAGGTGG - Intronic
1122314506 14:100817838-100817860 GGATTCCCAGGAAAGGCTGGTGG + Intergenic
1122519528 14:102333764-102333786 GGGTTCACAGGACAGCCAGGTGG - Intronic
1122705029 14:103615503-103615525 AGCTTCCCAAGAGAGCCAGGTGG + Intronic
1123801797 15:23829401-23829423 GGATGAGGAGGAAAGCCAGGAGG - Intergenic
1123991829 15:25689228-25689250 GAATTCCCAGAAAAGCTGGGAGG - Intronic
1126540426 15:49816466-49816488 GGGTCCCCAGAAAAGCTAGGGGG + Intergenic
1128496316 15:68200516-68200538 GGAGGCCCAGGAAGGCCAGCTGG + Intronic
1129032380 15:72628690-72628712 CTTTTCACAGGAAAGCCAGGTGG + Intergenic
1129217514 15:74108549-74108571 CTTTTCACAGGAAAGCCAGGTGG - Intronic
1129224273 15:74157798-74157820 AGATTCCCAGGAAAGACAGAGGG - Intergenic
1129356607 15:74996004-74996026 GGTTTCCAGGGAACGCCAGGTGG - Intronic
1129457549 15:75683770-75683792 GGAAGCCCAGGAATGCCAGAAGG - Intronic
1129726247 15:77903174-77903196 GGAAGCCCAGGAATGCCAGAAGG + Intergenic
1129789110 15:78328835-78328857 GCAATCCCTGGCAAGCCAGGAGG - Intergenic
1129920952 15:79318758-79318780 GCATTCCCCGGAGAGCTAGGAGG + Intronic
1130274298 15:82468536-82468558 GGAAGCCCAGGAATGCCAGAGGG + Intergenic
1130466644 15:84195910-84195932 GGAAGCCCAGGAATGCCAGAGGG + Intergenic
1130497620 15:84477626-84477648 GGAAGCCCAGGAATGCCAGAGGG - Intergenic
1130588940 15:85200503-85200525 GGAAGCCCAGGAATGCCAGAGGG + Intergenic
1130677310 15:85964680-85964702 GGATTGCCAGGAAATCCTTGAGG - Intergenic
1132004152 15:98211444-98211466 GGAGTCCCAGGAAAGCCAATGGG + Intergenic
1132787337 16:1664947-1664969 GGGTGCCCAGCATAGCCAGGTGG - Intronic
1133597939 16:7310967-7310989 GGATTCCCAGGCAATCCAGCAGG - Intronic
1133885943 16:9827737-9827759 GGGATCCCAGGAGATCCAGGTGG + Intronic
1133897853 16:9946325-9946347 TGATTCCCACTAAAGCCAGAGGG + Intronic
1135971383 16:27074392-27074414 GGGTTCCCAGGAGAAGCAGGGGG + Intergenic
1137707165 16:50543673-50543695 GGCTTCCCAGGTGAGCCTGGAGG - Intergenic
1137716628 16:50602123-50602145 GGAGGCCCAGGAAAGCCCTGGGG + Intronic
1137718512 16:50613378-50613400 GGCTTCCCAGGAAGGCTGGGAGG + Intronic
1138554717 16:57764727-57764749 GGATTCCTAGGAAGGCCCAGGGG + Intronic
1138581846 16:57946582-57946604 GCATCCCCAGGGAGGCCAGGTGG + Intronic
1139973545 16:70791247-70791269 GGATCATCAGGAAAGGCAGGGGG - Intronic
1140224405 16:73066644-73066666 GGATGCCCAGAAAAGCCACGAGG + Intergenic
1141930252 16:87197424-87197446 GGAGGTCCAGGAAAGCCTGGTGG + Intronic
1142542611 17:672058-672080 GGTTCCCCAGGAAGGGCAGGAGG + Intronic
1142762624 17:2050851-2050873 GGAGCCCCAAGAAAGCCGGGGGG + Intergenic
1143969894 17:10787859-10787881 GGATTCCCAGAAAAGGGAAGGGG + Intergenic
1144343708 17:14331866-14331888 GGCTTCCTAGGAAAGGAAGGAGG + Intronic
1148755812 17:49972398-49972420 GGGGTCCCTGGAAACCCAGGCGG + Intronic
1149259666 17:54864960-54864982 GGAATCCAAGGAAAACCAGAGGG - Intergenic
1150762434 17:67974700-67974722 GGATTCCGATGAACACCAGGTGG + Intronic
1151345590 17:73499431-73499453 GGAGGCCCAGGAGAGCCAGGTGG - Intronic
1151873165 17:76850426-76850448 GGATTGTCAGGAAACCAAGGAGG + Intergenic
1151879591 17:76887153-76887175 GTGTTCCCAGGACACCCAGGTGG - Intronic
1152309176 17:79538733-79538755 TTATTCCCAGGAGACCCAGGAGG + Intergenic
1152702378 17:81825441-81825463 GGAGTCCCAGGATTCCCAGGAGG + Exonic
1152736496 17:81999912-81999934 ACAGTCCCAGGACAGCCAGGGGG - Intronic
1155240164 18:23857075-23857097 GGGTTCCCAGCAATCCCAGGAGG + Intronic
1155386367 18:25282341-25282363 GGAACCACTGGAAAGCCAGGCGG + Intronic
1157322804 18:46647188-46647210 GGGATCTCAGCAAAGCCAGGAGG + Intronic
1157323758 18:46654574-46654596 GGAATCCCAGGGTAGCCAGAAGG + Intronic
1160344858 18:78124252-78124274 GGATTCCCAGAGAAGGCAGTGGG + Intergenic
1162424618 19:10587059-10587081 GGATTCCCAGGGATTGCAGGGGG + Intronic
1162953463 19:14085491-14085513 GGGTTCCCAGGCCTGCCAGGGGG + Exonic
1163398375 19:17076943-17076965 GGGTGCCCAGGAAAGAAAGGAGG - Intronic
1163761054 19:19137092-19137114 GGTCTCCCAGGAGAGCCTGGAGG - Intronic
1164473704 19:28556327-28556349 GAATTCCCAGCAAAACCTGGTGG + Intergenic
1165397058 19:35570236-35570258 AGATTCCCAGGGGAGCAAGGAGG + Intergenic
1167249747 19:48393594-48393616 GGGTCCCCAGGGAGGCCAGGAGG + Intergenic
1167755570 19:51411203-51411225 AGAATCCCAGGAGAGCCAAGAGG - Exonic
1168681363 19:58318324-58318346 TGACTCCCAGGAAGGCAAGGGGG + Intergenic
925165748 2:1714543-1714565 GCATTCCCTGAAAGGCCAGGTGG + Intronic
925377909 2:3401264-3401286 GGACCTCCAGGAAAGCCTGGAGG - Intronic
929735477 2:44543682-44543704 GGATTTTCAGGAAAGCTAGGTGG + Intronic
931288291 2:60850525-60850547 GGAGTCCCTGGGCAGCCAGGGGG + Intergenic
931431167 2:62210087-62210109 CCATTCCAAGGAAAGGCAGGGGG - Intronic
932433873 2:71691801-71691823 GGATTTCCAGAGGAGCCAGGTGG + Intergenic
934942327 2:98511625-98511647 GGACTCCCAGGGAAGTGAGGTGG - Intronic
935328054 2:101955808-101955830 GGAGACCCAGGAAACCCAGGTGG + Intergenic
935603248 2:104944044-104944066 AGATTCCCAGGGAAGGCAGTGGG - Intergenic
944434423 2:199671737-199671759 AGATTGCCAGGAAAGCCAGCTGG - Intergenic
946192764 2:218016155-218016177 GGTTTCCCAGGAAGGGGAGGGGG - Intergenic
947798964 2:232915106-232915128 CAAATCCCAGGAGAGCCAGGAGG - Intronic
948247565 2:236499307-236499329 TGTTTCCCTGGGAAGCCAGGTGG - Intronic
1170255920 20:14342998-14343020 GGCCTCCCAGGAAAGAAAGGAGG + Intronic
1171334602 20:24371676-24371698 GGTTCCCCAGAAAAGCAAGGGGG + Intergenic
1172388833 20:34552527-34552549 GGATTCCTAGAGTAGCCAGGAGG + Intronic
1174074766 20:47925799-47925821 TGATTCACAGGAAAGCCCGGGGG + Intergenic
1174338889 20:49883765-49883787 GGCTTCCCTGGAAATCCAGCCGG - Intronic
1174564766 20:51456792-51456814 GGAGGCCCAGGCAAGGCAGGAGG - Intronic
1175335986 20:58196620-58196642 GGATGCGCTGGAGAGCCAGGTGG - Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1175965865 20:62660020-62660042 GGGTTCCCAGGGACGCCAGAGGG - Intronic
1177563754 21:22791698-22791720 GAACTCTCAGGAAAGCCAAGAGG - Intergenic
1178885068 21:36478829-36478851 GGCTTCCCAGGATGGGCAGGAGG - Intronic
1180085011 21:45504533-45504555 GGAATCCCAGGGTAGCCACGTGG - Exonic
1180244650 21:46539001-46539023 GGACACCCAGGCAAACCAGGAGG - Intronic
1182151737 22:28032005-28032027 GCAGACCCAGGAAAGCCAGTAGG - Intronic
1182940130 22:34269058-34269080 GGCTGCCCAGCAGAGCCAGGAGG + Intergenic
1183473859 22:38024988-38025010 GGAATGTCAGGGAAGCCAGGTGG + Intronic
1184396948 22:44247888-44247910 GGAAGCACAAGAAAGCCAGGTGG - Exonic
1184628274 22:45755027-45755049 TGGTGCTCAGGAAAGCCAGGTGG + Intronic
1184669542 22:46005563-46005585 GGGTCCCCAGGGCAGCCAGGTGG - Intergenic
1184918108 22:47587111-47587133 GGAGCCCCAGGACAGCCAGCAGG - Intergenic
1185106646 22:48874178-48874200 TCATTCCCAGGAATGTCAGGTGG - Intergenic
1185139484 22:49092357-49092379 GGTGTGCCAGGAAGGCCAGGAGG + Intergenic
1185383780 22:50522387-50522409 GGATTCCCTGGAAGACCTGGGGG + Exonic
949703004 3:6780742-6780764 TGACTCCAAGGAAAGCGAGGAGG - Intronic
953511742 3:43548136-43548158 GGATTGACCAGAAAGCCAGGTGG - Intronic
953665904 3:44926285-44926307 GGATGCATGGGAAAGCCAGGAGG - Exonic
953669237 3:44948657-44948679 GGGATCCTAGGAAGGCCAGGAGG + Intronic
954745249 3:52784130-52784152 AGTCTCCCAGGAGAGCCAGGAGG + Intronic
955000192 3:54920431-54920453 GGATTGCTAGAGAAGCCAGGAGG - Intronic
955329446 3:58034888-58034910 GCAGTCCCAGGAAAGCCCTGAGG + Intronic
956491115 3:69773248-69773270 GGAGTTCCAGGAATGGCAGGAGG + Intronic
957190816 3:77007101-77007123 CAATGCCCAGGAAAACCAGGTGG + Intronic
958171804 3:89947986-89948008 GGATTTCCAGGTTAGCCAGGGGG - Intergenic
960088450 3:113615132-113615154 GGGCTGCCAGGACAGCCAGGTGG - Intronic
960193124 3:114731177-114731199 GGATTAACAGGAAATTCAGGAGG - Intronic
960416424 3:117390357-117390379 AAAGACCCAGGAAAGCCAGGGGG + Intergenic
960993067 3:123324274-123324296 GGACTCCCTGGAAATCCAGCAGG - Intronic
961835128 3:129651645-129651667 GGACTGCCATGACAGCCAGGAGG + Exonic
962168713 3:133077915-133077937 GTCTTCCCAGGACAGCCCGGGGG + Intronic
962340356 3:134577070-134577092 AGATTCCCAGGAAAGGGAGTGGG + Intergenic
962872532 3:139510027-139510049 GGATTCACAGTGAAGCCAGATGG + Intergenic
963835833 3:150057046-150057068 CCATCCCCAGAAAAGCCAGGAGG - Intergenic
966674273 3:182568380-182568402 GGATTCCTGGGAAAGCCTGGAGG + Intergenic
968231493 3:197007409-197007431 CCATTTCCAGGAAATCCAGGTGG + Intronic
968524589 4:1049506-1049528 GCTGTCCCAGGACAGCCAGGAGG - Intergenic
968687681 4:1972510-1972532 GGAGTCACAGGAATGCCATGGGG - Intronic
968893729 4:3386266-3386288 GGTGTCCCGGGAAAGCCAGACGG - Intronic
968972690 4:3804118-3804140 GAGCTCCCAGGAAACCCAGGAGG - Intergenic
969219807 4:5752270-5752292 GGACTCTCAGAAAAGACAGGGGG - Intronic
969294607 4:6262578-6262600 GGATTCCCAGCAAAGCTGAGTGG - Intergenic
969472767 4:7399500-7399522 GGATCATCAGGGAAGCCAGGAGG - Intronic
969524878 4:7699334-7699356 TCATTCCCAGGATGGCCAGGAGG + Intronic
969880195 4:10167046-10167068 TGAGTTCCAGGAAAGCCAGGAGG - Intergenic
975611367 4:76206885-76206907 GGACTCACAGGAAAGCCAAAAGG + Intronic
978310372 4:107380184-107380206 GGATTCTCAGCAAAGCGGGGAGG + Intergenic
978495903 4:109358756-109358778 GGAGACCCAGGAAAGCCAGTGGG - Intergenic
979799224 4:124887150-124887172 GGCAACCCAGGAAAGCCATGGGG + Intergenic
985912815 5:2896654-2896676 GGCTTCCCTGGATTGCCAGGGGG + Intergenic
986222151 5:5777589-5777611 AGATGCCTAGAAAAGCCAGGAGG + Intergenic
986418252 5:7550006-7550028 GGGGTCCCAGGAAAACCAAGTGG - Intronic
987100781 5:14589578-14589600 AGAGTCCCAGGCAAACCAGGAGG + Intronic
987126240 5:14815533-14815555 GGGTTCCCTGGAAACCCTGGTGG - Intronic
988892680 5:35636396-35636418 GGATGCCTAGGAAAGACATGAGG - Intronic
989431899 5:41365379-41365401 GGATTCCAAGGAAAGAAAGATGG - Intronic
990447504 5:55906232-55906254 AGATTCCCAGGAAAGGGTGGTGG - Exonic
992894655 5:81235575-81235597 GGATGCCCAGGAAGAGCAGGGGG + Intronic
994321484 5:98399967-98399989 GAATTCTGAGGAAAGGCAGGGGG - Intergenic
997583766 5:135033139-135033161 GGACTCCCAGCAAGGCCAGCCGG - Intronic
997795902 5:136810651-136810673 TGATTCCCATGTAAGCCAGCTGG + Intergenic
997977472 5:138448754-138448776 GGATTCCAAGGAAAGACAAAAGG - Intergenic
999395190 5:151222819-151222841 GGAGAGCAAGGAAAGCCAGGAGG + Intronic
999755808 5:154663612-154663634 CTATGCCCAGGAAAGCCACGGGG - Intergenic
1000242625 5:159422804-159422826 GGAGTCCCAGAAATTCCAGGGGG - Intergenic
1001055466 5:168445760-168445782 GGATTCCCAGTAACACCATGGGG - Intronic
1002438418 5:179249786-179249808 GAATTCCCAGTAAAGCCATCTGG - Intronic
1006803553 6:36774620-36774642 GGATTCCAGGGAAACCCAGATGG - Intronic
1008511402 6:52279113-52279135 AAACTCCCAGGAAAGCCATGAGG + Intronic
1010662958 6:78592643-78592665 GGAGACCCAGGAAATCCAGTGGG + Intergenic
1013980300 6:116121160-116121182 GGACCCCCAGGAAGGCCAGCAGG + Exonic
1015709230 6:136121212-136121234 AGAATCACAGGAAAGCAAGGAGG - Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1017223909 6:151997883-151997905 GCAAGCCCAGGAAAGCCACGGGG + Intronic
1019373585 7:676792-676814 TGATTCCCAGGAGAGCAACGGGG + Intronic
1019421451 7:953101-953123 CGCTCCCCAGGAAAGCCAGTGGG - Intronic
1019564367 7:1672127-1672149 CGACTCCCAGAAAAGCCAGTGGG + Intergenic
1020013961 7:4820504-4820526 GGATGCCCACCAAGGCCAGGAGG + Intronic
1021144675 7:17070595-17070617 GAGTTCCCAGGAAAACCAGAGGG - Intergenic
1022173669 7:27852907-27852929 GGATTACCAAAAGAGCCAGGAGG - Intronic
1022664967 7:32402328-32402350 GGAGGCCCAAGAAAGCCAGTGGG + Intergenic
1027613081 7:80387166-80387188 GTATTTCCAGGAAAACAAGGTGG + Intronic
1030148052 7:106376359-106376381 GGAGACCCAGGAAAGCCAATGGG + Intergenic
1030516415 7:110544081-110544103 GGAGTCTCAGGAATGGCAGGAGG + Intergenic
1030580959 7:111354512-111354534 GGATGCCCATGAAAGTCAAGAGG + Intronic
1030620501 7:111785106-111785128 GGATGCACAGGAAACACAGGAGG - Intronic
1031879941 7:127186411-127186433 GGCGTCCCAGGAAGGCCAAGTGG + Intronic
1033261135 7:139844985-139845007 TGATTCCCAGCATAGCCTGGGGG - Intronic
1034226282 7:149486255-149486277 GTATTCCCAGGAGGGCCTGGGGG - Intronic
1034694934 7:153044671-153044693 GGTGTCCCAGGAAAGCTACGGGG - Intergenic
1035051536 7:156001636-156001658 GGATTCCCTGGGAAGCCAGAGGG - Intergenic
1035526481 8:317052-317074 GGACTCCCTGGTGAGCCAGGTGG + Intergenic
1036133768 8:6140207-6140229 GGCAGCCCAGGAATGCCAGGCGG + Intergenic
1037690892 8:21180601-21180623 TTAGTCACAGGAAAGCCAGGAGG - Intergenic
1038162812 8:25056251-25056273 GGAAACCCAGGAAAGCCAAGTGG + Intergenic
1038588338 8:28811763-28811785 GGGTGCCCAGGAAAGCCAATGGG - Intronic
1038607034 8:29017192-29017214 GGAAGCCCAGGATAGCCATGTGG - Intronic
1038676105 8:29624257-29624279 GAGTTGGCAGGAAAGCCAGGAGG - Intergenic
1038943342 8:32330140-32330162 GTAATCCCAGGTAAGGCAGGAGG - Intronic
1039130933 8:34263349-34263371 GGATTCTGAGGAAAGAGAGGAGG - Intergenic
1040325515 8:46339560-46339582 GCTTTCCCGGGAAAGCCATGGGG - Intergenic
1040585445 8:48736222-48736244 GGAATCTGAGGAAAGCCACGAGG + Intergenic
1041831341 8:62157783-62157805 GGTTTCACAGGATAGCTAGGTGG - Intergenic
1043482696 8:80669010-80669032 GGGATCCCAGGAAAGCAAAGTGG + Intronic
1044544036 8:93439122-93439144 ATATTCCCAGGTCAGCCAGGAGG - Intergenic
1046035814 8:108840154-108840176 GGAGACCCAGGAAAGCCAATGGG + Intergenic
1046422917 8:114008166-114008188 GTAGTCCCAGGAGAGGCAGGAGG - Intergenic
1046806358 8:118482921-118482943 TTATTCCCAGGGAAGCCACGAGG + Intronic
1048874052 8:138822770-138822792 GGAGCCACAGGGAAGCCAGGAGG - Intronic
1050178149 9:2891015-2891037 GGAGGCCCAGGAAAGCCCAGCGG + Intergenic
1050314038 9:4382865-4382887 AGATTCCCAGGAAGACCAGCTGG + Intergenic
1050631908 9:7568623-7568645 GGATTCCCAGGTAAAGCAGTAGG + Intergenic
1051362046 9:16289691-16289713 GGTGTCCCAGGCAAGCAAGGGGG + Intergenic
1052969779 9:34370413-34370435 AGATGGCCACGAAAGCCAGGAGG + Exonic
1053491216 9:38505084-38505106 GGAGCCCCAGCAAATCCAGGTGG - Intergenic
1055806544 9:80101333-80101355 GAATTCACAGGAAAGCCATCTGG + Intergenic
1055925909 9:81509649-81509671 GTATTCACTGGAAAGCCAGCTGG + Intergenic
1056597397 9:88019077-88019099 AGCTTCCCAAGAAAACCAGGTGG - Intergenic
1056881239 9:90395880-90395902 GGAGTCCCAGGAAGGGCAGCTGG - Intergenic
1057671523 9:97094285-97094307 GGAGCCCCAGCAAATCCAGGTGG - Intergenic
1057911732 9:99024895-99024917 GGAATCCCAGGTAAGCCAGGTGG - Exonic
1057915151 9:99049693-99049715 GGAGGGCCAGGTAAGCCAGGTGG - Exonic
1058574356 9:106384179-106384201 GGACTCCCAGGAATTCCAGAGGG - Intergenic
1058673506 9:107380632-107380654 GGAGTATCAGGAAAGTCAGGTGG - Intergenic
1060149842 9:121281610-121281632 GGCTGCCCAGGGAAGCCTGGAGG + Intronic
1060417452 9:123442261-123442283 GCCCTCCCAGTAAAGCCAGGAGG - Intronic
1061015332 9:127978058-127978080 GGCTTCCCAGGCAACCAAGGAGG + Intronic
1061662154 9:132137385-132137407 GGTTTCCCAGGACAGGCTGGAGG - Intergenic
1062051009 9:134447078-134447100 GGCTTCAAAGGGAAGCCAGGTGG + Intergenic
1186082233 X:5945600-5945622 GGATTCCCAGGAAAGCCAGGAGG + Intronic
1186464052 X:9770657-9770679 AGATTCCCAAGAAACCCAGCTGG - Intronic
1186726179 X:12361484-12361506 GCATTCCCAGCAAAGCCCAGTGG - Intronic
1190034671 X:47010469-47010491 GTAATCCCAGCCAAGCCAGGCGG - Intronic
1190325429 X:49204424-49204446 GTGGTCTCAGGAAAGCCAGGTGG + Intergenic
1192342844 X:70278255-70278277 GGATTCCCAGGAGAACTAGATGG + Intronic
1193248587 X:79260850-79260872 GTATTCACAGGAAAGCTAGTTGG + Intergenic
1195618172 X:106929233-106929255 GGAGTCCCAGGTAAACCAGAGGG - Exonic
1195791052 X:108586723-108586745 GGAGGTCCAGGAAGGCCAGGTGG - Exonic
1196951031 X:120875607-120875629 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196951862 X:120931979-120932001 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196952546 X:120936840-120936862 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196953231 X:120941701-120941723 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196953916 X:120946561-120946583 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196954601 X:120951422-120951444 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196955284 X:120956282-120956304 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196955971 X:120961165-120961187 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196956653 X:120966026-120966048 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196957335 X:120970886-120970908 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196958017 X:120975746-120975768 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196958699 X:120980606-120980628 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1196959380 X:120985466-120985488 GGAGGCCCCGGTAAGCCAGGAGG - Exonic
1199708517 X:150451471-150451493 GGATTCCCAGTAAAAGCAAGAGG - Intronic
1199950169 X:152700300-152700322 GGATTCCCAGAACTGTCAGGAGG - Intronic
1199959507 X:152768161-152768183 GGATTCCCAGAACTGTCAGGAGG + Intronic
1200899566 Y:8415966-8415988 GTAATCCCAGGAAGGCAAGGCGG - Intergenic
1200971516 Y:9157593-9157615 GGAGTCCCAGAAAATCCAGGGGG + Intergenic
1201973096 Y:19817303-19817325 GGATTCGCAGCAAAGCGGGGAGG - Intergenic
1202139503 Y:21706704-21706726 GGAGTCCCAGAAAATCCAGGGGG - Intergenic