ID: 1186082540

View in Genome Browser
Species Human (GRCh38)
Location X:5948976-5948998
Sequence CACCATGCATAGCCTCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186082538_1186082540 8 Left 1186082538 X:5948945-5948967 CCGGGAGTGAAGCTAAAGCTACT 0: 1
1: 0
2: 2
3: 89
4: 120
Right 1186082540 X:5948976-5948998 CACCATGCATAGCCTCTCCATGG 0: 1
1: 1
2: 1
3: 11
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186082540 Original CRISPR CACCATGCATAGCCTCTCCA TGG Intronic
902284637 1:15399276-15399298 CACCATGCCTGGCCTCTCACTGG - Intronic
902341278 1:15785043-15785065 CACCATGCCCAGCCTCTAAAAGG - Intronic
903270975 1:22188071-22188093 CACCATGCCCGGCCTCTCCTGGG + Intergenic
906935450 1:50210553-50210575 CAACATGAATATCCTCTCCCCGG + Intergenic
908669439 1:66530641-66530663 CACCATGCCTGGCCTCTCATAGG - Intergenic
909053355 1:70794643-70794665 CACCATGCCTAGCTTCTTCTAGG - Intergenic
911303830 1:96208672-96208694 CACCATGTCTAGACACTCCAGGG + Intergenic
912961869 1:114203167-114203189 CACCGTGCCTAGCCTCTCTTTGG - Intergenic
915290510 1:154879981-154880003 CTCCATGAGCAGCCTCTCCAGGG + Intergenic
915406437 1:155663430-155663452 CACCATGCCTGGCGTATCCATGG - Intronic
915962915 1:160282144-160282166 GTCCATGCCTAGCCCCTCCATGG + Exonic
917361517 1:174181623-174181645 CACCATGCCCAGCCTGTACAAGG + Intronic
918496867 1:185149629-185149651 CACCATGCAGTTCCTCTCCTAGG - Intronic
918996813 1:191772607-191772629 AAACATGCATAGCATCCCCATGG + Intergenic
919869497 1:201809735-201809757 CACCATGCATGGCTTCTCACAGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063701193 10:8386932-8386954 CACCATGCCTGGCCTATGCAGGG + Intergenic
1067746999 10:48943518-48943540 CAGCATGCAGAGCCTCTGCTAGG + Intronic
1069033104 10:63618533-63618555 CACCATGCCCGGCCTCTTCATGG + Intronic
1070115013 10:73520124-73520146 GACCATGCATATGCTGTCCAGGG + Intronic
1071310519 10:84339290-84339312 CACTGTGCCCAGCCTCTCCAGGG + Intronic
1076748765 10:132529258-132529280 CACCATGCCTGGCCTATTCATGG + Intergenic
1076801852 10:132834658-132834680 CCCCCTGCTCAGCCTCTCCAAGG - Exonic
1077244651 11:1530636-1530658 CACCATGCCCAGCCTCAACAAGG + Intergenic
1078007860 11:7546069-7546091 GAGCTTCCATAGCCTCTCCAGGG - Intronic
1078477721 11:11646270-11646292 CTGCATGCTTAGCCTTTCCAGGG - Intergenic
1080490302 11:32755245-32755267 CACCATGCCTGGCCTCTGAAAGG - Intronic
1080769264 11:35325443-35325465 CACCATGCCTAGCATCTTCCTGG + Intronic
1084118151 11:67053884-67053906 CACCCTGCCAAGCCACTCCAAGG + Intergenic
1084608344 11:70185486-70185508 CACCAAGCTGAGCCTCTCCCAGG + Intronic
1084979392 11:72821316-72821338 CACCATGCATAACCACTGCGAGG - Intronic
1085933919 11:81121540-81121562 GATCATGCAGAGCCTTTCCAGGG - Intergenic
1087956499 11:104294737-104294759 CACCTTGCTTGGGCTCTCCAAGG + Intergenic
1089362829 11:117902367-117902389 CACCTAGCACTGCCTCTCCAAGG + Intronic
1089392583 11:118112098-118112120 CACCAAGCATGGCCTCTTCCTGG + Intronic
1091309323 11:134561370-134561392 CTCCAGGCAAAGCCTCTCCCTGG - Intergenic
1093130761 12:15389393-15389415 CACCACACCTGGCCTCTCCAGGG + Intronic
1096967708 12:55641686-55641708 CACAGTGCACAGCGTCTCCAAGG + Intergenic
1097447147 12:59685320-59685342 CACTATGAAAATCCTCTCCAAGG - Intronic
1097498480 12:60373492-60373514 CATCAGGCAAAGCCTCCCCATGG + Intergenic
1098242881 12:68486447-68486469 CACCATGCCCAGCCTCTCAATGG - Intergenic
1101608548 12:106269192-106269214 CACCAGGCCCAGCATCTCCATGG + Intronic
1102035066 12:109766295-109766317 CCCCATCCATAGCCCCTCCCTGG - Intronic
1103735531 12:123058518-123058540 CCCCACCCACAGCCTCTCCAGGG + Intronic
1103863189 12:124030283-124030305 CCCCACTCACAGCCTCTCCAGGG - Intronic
1106607361 13:31241464-31241486 CAGCAGGGATGGCCTCTCCAGGG + Intronic
1106647010 13:31647204-31647226 CACTATGCAGTGGCTCTCCACGG + Intergenic
1107647084 13:42505507-42505529 CACCATGCCTGGCCTCTTCTAGG + Intergenic
1108006382 13:45951031-45951053 CACCATGCCCAGCCTATTCATGG - Intergenic
1110362469 13:74642990-74643012 ACACATGCATATCCTCTCCAAGG + Intergenic
1113931654 13:113971969-113971991 CACCCTGCACAGCCTCCCCCAGG - Intergenic
1115559296 14:34568788-34568810 CACCATTTTTAGCCCCTCCAGGG + Intronic
1116000936 14:39242236-39242258 CATCATGGAAGGCCTCTCCAAGG - Intronic
1117899546 14:60517472-60517494 CACCATGCTTAGGCTCACCTAGG + Intergenic
1118842056 14:69520831-69520853 CATCATGCATTGCCTCTTAAAGG + Intronic
1119826373 14:77660442-77660464 CACCACGCCTGGCCACTCCAGGG - Intergenic
1122146991 14:99697232-99697254 TTCCATGCATAGCTTCTCCCTGG + Intronic
1127123954 15:55794282-55794304 CACCATGCAGAGTCTCTACTGGG + Intergenic
1128222260 15:65977676-65977698 CACCATGCAAAACCTCTCTTTGG + Intronic
1129834501 15:78693563-78693585 GACCTTGGATAGACTCTCCAGGG + Intronic
1131955877 15:97735882-97735904 GAGCATGTATATCCTCTCCAGGG + Intergenic
1132411079 15:101578654-101578676 CCCCATGCACAGCCTCTCTGCGG + Intergenic
1132826215 16:1906988-1907010 CTCCCTGCATAGCTTCTGCAGGG + Intergenic
1133211781 16:4267320-4267342 CACCATGCCCAGCCACACCAAGG + Intronic
1133947587 16:10362111-10362133 CACCATGCCCAGCCTTCCCAGGG + Intronic
1134029219 16:10978372-10978394 CACCATGCAGAGGTGCTCCAAGG + Intronic
1135125700 16:19807604-19807626 CAGCATGCAAAGACTCTCCTGGG - Intronic
1138486628 16:57349371-57349393 CCCCATACAGAGCCTCTCCTGGG + Intergenic
1140111810 16:72011348-72011370 CACCGTGCCCAGCCTCTACATGG - Intronic
1140760118 16:78102290-78102312 CCCCCTGCATGGCCTGTCCAGGG + Intronic
1141494261 16:84396094-84396116 CACCAGGCATAACATCTTCAAGG + Intronic
1141988583 16:87596004-87596026 CACCATAAACACCCTCTCCAGGG - Intergenic
1143320019 17:6062163-6062185 CACCACGCCTAGCCTCACCTAGG - Intronic
1146427047 17:32750323-32750345 CACCACGCCTGGCCTCCCCAGGG - Intronic
1147816792 17:43216285-43216307 CACCATTCAATGCCCCTCCAAGG + Intronic
1149411675 17:56414729-56414751 CACCATGCCTAGCCTTTTGAGGG - Intronic
1149875208 17:60225663-60225685 CACCATGCCTGGCCTCCCCATGG - Intronic
1150047597 17:61928464-61928486 CCCCGTGCATTGCCTCTCTAAGG - Intergenic
1152125559 17:78444642-78444664 CACCATGCACAGCTTCTGCAGGG + Exonic
1156065929 18:33142328-33142350 CAACATGGAAAGCCCCTCCATGG + Intronic
1160298776 18:77660043-77660065 CAGCATTCATATGCTCTCCACGG + Intergenic
1163534065 19:17866917-17866939 CACCACGCCCAGCCTCTGCATGG - Intergenic
1163936259 19:20447070-20447092 CACCATGCCTGGCCTTTCTAGGG - Intergenic
1164098764 19:22035576-22035598 CACAATGCACAGCATATCCAGGG + Intergenic
1164534156 19:29072362-29072384 CACCATGCCTGGCCACTCCCTGG - Intergenic
1164740938 19:30575293-30575315 CTCCATGGACAGCCCCTCCATGG + Intronic
1164897851 19:31892730-31892752 CAGCATGCATATCTTCTCCCAGG - Intergenic
1165465223 19:35970531-35970553 CACCATGCCCAGCCTCACGAAGG - Intergenic
1166886564 19:45964847-45964869 CACCATGCCTGGCCTCTGCCTGG + Intronic
1167027523 19:46931929-46931951 CACCATGCCCAGCCACTCCTAGG + Intronic
925001791 2:409099-409121 CAGCATGCCTGGCCTCTTCAGGG - Intergenic
927351298 2:22119737-22119759 CACCGTGCACAGCCTCTCTTTGG - Intergenic
928137391 2:28698118-28698140 CACCATGCTCAGCCTATGCATGG + Intergenic
929020142 2:37545371-37545393 CATCATGGATTGGCTCTCCATGG - Intergenic
930721213 2:54640017-54640039 CAGCATGTATAGTCTCTGCATGG + Intronic
930778153 2:55196004-55196026 CACCAAGCACAGGTTCTCCATGG - Intronic
941669589 2:168278058-168278080 CACCATGGAAAGCCTTGCCATGG + Intergenic
942682810 2:178495869-178495891 GGCCATGCACAGCCCCTCCAAGG - Intronic
942718137 2:178918119-178918141 CACCATGCCTAGCCTCATGAGGG - Intronic
948685487 2:239667107-239667129 CACCATGCTCACTCTCTCCAGGG + Intergenic
948910534 2:241000161-241000183 CACCATCCACATCCTCTGCATGG + Intronic
948912719 2:241012399-241012421 CACCCTGCATCGCCACCCCAGGG + Intronic
1168910737 20:1444703-1444725 CACCTAGCAAAGCCTCTGCATGG + Intronic
1169006530 20:2212001-2212023 TGCCATGCAGGGCCTCTCCAAGG + Intergenic
1170201448 20:13748873-13748895 CACCATGCCCAGCCCCTCAAAGG + Intronic
1170588450 20:17753169-17753191 CAGAATGCAGTGCCTCTCCAGGG + Intergenic
1171419328 20:25007544-25007566 CATGTCGCATAGCCTCTCCATGG + Exonic
1172350157 20:34232630-34232652 CACCATACATAGCATAACCAAGG + Intronic
1173871646 20:46345764-46345786 CACCATGCCTGGCTTCTGCAGGG - Intergenic
1174823868 20:53751134-53751156 CAGCATGCAGCTCCTCTCCAAGG - Intergenic
1177225040 21:18243415-18243437 CAGAATCCATAGCCTCTACAAGG + Intronic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1179995731 21:44973314-44973336 CACCCTGCCCACCCTCTCCAGGG + Intronic
1181494464 22:23280210-23280232 CCCCAGGCACAGCCTATCCAGGG - Intronic
1182109363 22:27711843-27711865 CACCGTGCCTGGCCTCCCCAGGG + Intergenic
950185728 3:10944474-10944496 CACCATCCATAGCTTCTCTATGG - Intergenic
951185234 3:19704903-19704925 CACCATCCACTTCCTCTCCAAGG + Intergenic
953308965 3:41858438-41858460 CACCATGCCCAGCCTCCCAAAGG + Intronic
953552056 3:43910765-43910787 ATCCATGCAAAGCCTCTCCCAGG - Intergenic
954671936 3:52295722-52295744 AACCATGCTTGGCCTCTCCAGGG + Intergenic
961213107 3:125140871-125140893 CACCACGTCTAGCCTCCCCAGGG + Intronic
964994070 3:162852745-162852767 CACCATGAATAGCCACTGAAAGG + Intergenic
967995213 3:195161118-195161140 CAGCATGCAAAGCCTTCCCAGGG - Intronic
968072449 3:195793952-195793974 CACCATGCCTGGCCTCTGCCTGG - Intronic
968131738 3:196196262-196196284 CACCACCCAGAGCTTCTCCAAGG - Intergenic
968280449 3:197472962-197472984 CACCATGCTCAGCCCATCCAGGG + Intergenic
970335263 4:15032249-15032271 CACCATGCCCAGCCTCTAAATGG + Intronic
975314677 4:72938031-72938053 CACCATGCCTGGCTGCTCCATGG - Intergenic
975563953 4:75734230-75734252 CACCATGCCCAGCCTCTTCTCGG + Intronic
975797488 4:78024078-78024100 CACAATTAAAAGCCTCTCCAAGG + Intergenic
979549387 4:121973736-121973758 CACCATGCCTCACCTCTCCAAGG + Intergenic
980867143 4:138565103-138565125 CTTCATCCACAGCCTCTCCAAGG - Intergenic
981593199 4:146388468-146388490 CACCATGCGCAGCCTCTTCTAGG - Intronic
984864694 4:184271707-184271729 CACCATGCCTGGCCTCACCAAGG - Intergenic
985670498 5:1204261-1204283 CACCTGGCACAGGCTCTCCAAGG - Intronic
986132816 5:4946649-4946671 GCCCAAGCATAGCCTCTCCCTGG + Intergenic
989307109 5:39971088-39971110 CACAATGCCTAACCTCTCAAAGG - Intergenic
991063357 5:62401205-62401227 CACCATGCCCAGCCTCAACAGGG - Intronic
992415126 5:76545285-76545307 CACCACACATTTCCTCTCCACGG - Intronic
995518325 5:112976256-112976278 CAAAATGGATACCCTCTCCAAGG + Intergenic
996144914 5:119962671-119962693 CTCCATGGACAGGCTCTCCAAGG - Intergenic
996878836 5:128270236-128270258 CACCATGCCCAGCCTCTTCTAGG - Intronic
997197030 5:131987215-131987237 CACTTTGCTTAGCCTCTCCCTGG - Intronic
1001817549 5:174682753-174682775 CACCATGCCTGACCCCTCCATGG - Intergenic
1002613375 5:180435790-180435812 CACCATGGGCAGCCTCGCCAGGG + Intergenic
1006033181 6:31192638-31192660 CACCATGCCTGGCCTTTACAAGG + Intergenic
1009694349 6:67080986-67081008 CAGCAAGCAAGGCCTCTCCAAGG - Intergenic
1012178282 6:96117915-96117937 CACCATGCCTGGCCTCTAGATGG - Intronic
1015601126 6:134911714-134911736 CCCCTTGAATAGCCTCTCCAGGG + Intergenic
1016727171 6:147385499-147385521 CACACTGCATAGCCACTACATGG - Intronic
1017778450 6:157697835-157697857 GACCCTGCATAGCCTGGCCAAGG + Intergenic
1018375289 6:163204680-163204702 CACCTCCCATTGCCTCTCCATGG - Intronic
1018436273 6:163762056-163762078 CACCACGCCTGGCCTCTCCTAGG + Intergenic
1019655773 7:2194246-2194268 CACTATGCCCAGCCTCTGCATGG + Intronic
1020356298 7:7279429-7279451 CACCATCCCAAGCCTCACCACGG - Intergenic
1020544061 7:9500904-9500926 CACCGTGCCCGGCCTCTCCAAGG + Intergenic
1024710979 7:52014402-52014424 CACTATGCAAAGACTCTTCAGGG + Intergenic
1024734412 7:52288824-52288846 CACCATACATGTGCTCTCCACGG + Intergenic
1026182456 7:68053973-68053995 CATCATGCCTGGCCTCTCCCTGG - Intergenic
1026895075 7:74005639-74005661 CACCATGCCTGGCCTCCCCTAGG - Intergenic
1027133863 7:75610712-75610734 CACCATGCCTGGCCTCTACCTGG - Intronic
1027920792 7:84391681-84391703 CACCATGCCTGGCCTGTCAATGG - Intronic
1028870880 7:95770681-95770703 CACCATGCCTGGCCTCAACATGG - Intergenic
1029589852 7:101500199-101500221 CACCCTTCCTAGCCTTTCCAGGG + Intronic
1030670203 7:112326794-112326816 CACTATGCATAGTCTATCAATGG + Intronic
1031554962 7:123163149-123163171 CACCATGCATACAATTTCCATGG - Intronic
1032080718 7:128857176-128857198 CACCATTGATGGCCCCTCCAAGG + Exonic
1032165971 7:129545244-129545266 CACCACGCCTGGCCTCTCCTAGG - Intergenic
1032481748 7:132252587-132252609 CACCATGCCTGGCCTCTAAAAGG + Intronic
1033459154 7:141529674-141529696 CACCATGCCCAGCCTATCAAAGG - Intergenic
1034877460 7:154738217-154738239 CTCCAGGTATAGCATCTCCAGGG + Intronic
1035299061 7:157885378-157885400 ACCCAGGCCTAGCCTCTCCAGGG + Intronic
1035477933 7:159156910-159156932 CACCAAGCATAGCTTCCCGAGGG - Intergenic
1036721998 8:11184818-11184840 CACCATGCACAGCCTCAATAAGG + Intronic
1036979226 8:13450165-13450187 CACCATGCCTGGCCTCTCCTTGG - Intronic
1037162512 8:15790469-15790491 CACCATGCCCGGCCTCACCATGG + Intergenic
1037414942 8:18640001-18640023 AGCCATGCAAAGCCTGTCCAGGG + Intronic
1040508792 8:48075375-48075397 CTCCATGCATGCCCTTTCCATGG + Intergenic
1041775408 8:61517196-61517218 CACAATGCATAACATCTGCAGGG + Intronic
1045046788 8:98286518-98286540 CACCATGCCTAGCCTCAACAAGG - Intronic
1045285022 8:100783152-100783174 CACCATGCCTGGCCTCACAATGG - Intergenic
1045424939 8:102056530-102056552 AACCATCCAGAGTCTCTCCATGG + Intronic
1045903420 8:107312856-107312878 CACCATGCCTGCCCTCTCGATGG + Intronic
1046348777 8:112976002-112976024 CACCATCCATAGACTTTCCGAGG - Exonic
1048556367 8:135481487-135481509 CACAAAGCATACCCTCTACAGGG - Intronic
1048887392 8:138919321-138919343 CATCATGAGTCGCCTCTCCAGGG + Intergenic
1051097435 9:13482924-13482946 CACCAAGCATTGCTTCTCAACGG + Intergenic
1053583627 9:39433764-39433786 GACCATGCCTGGACTCTCCAAGG - Intergenic
1056024148 9:82475212-82475234 CACCATGCCCAGCCTATACATGG - Intergenic
1057114382 9:92506823-92506845 CACTGTGCACAGCCACTCCAGGG - Intronic
1059550943 9:115228226-115228248 CACTTTGCATATCCACTCCATGG + Intronic
1060539921 9:124422398-124422420 CACCACGCCTGGCCTCTACAAGG - Intergenic
1061304574 9:129724900-129724922 CACCAAGCAAATCCCCTCCATGG - Intergenic
1062385232 9:136306732-136306754 CACCACGCAGAGCCACTGCATGG + Intronic
1186082540 X:5948976-5948998 CACCATGCATAGCCTCTCCATGG + Intronic
1186961071 X:14736866-14736888 CACCATGCCTGGCCTCACAATGG - Intergenic
1187929290 X:24279387-24279409 CATCATGCTTAGCCTCTTCCTGG - Intergenic
1189672306 X:43424151-43424173 CACTACACATGGCCTCTCCATGG - Intergenic
1189992720 X:46609737-46609759 CACCATGCCTGGCCTCTCCATGG - Intronic
1190641233 X:52483657-52483679 CAGCATGCAGACCCTCCCCAAGG + Intergenic
1190646439 X:52529208-52529230 CAGCATGCAGACCCTCCCCAAGG - Intergenic
1190875623 X:54458258-54458280 CACCACGCCCAGCCTCACCAAGG - Intronic
1192329160 X:70160176-70160198 CACCAGGCCCAGCTTCTCCATGG + Intronic
1193260235 X:79397828-79397850 CACCATGCATGGCCTTTCTTAGG - Intergenic
1194040199 X:88931695-88931717 CACCAACCATAGCCTCTGCTGGG + Intergenic
1195540676 X:106059116-106059138 ACCCATGTATAGCCACTCCATGG - Intergenic
1195960274 X:110378864-110378886 CAGCAAGCACAGCTTCTCCATGG + Intronic
1195960295 X:110378987-110379009 CAGCAAGCACAGCTTCTCCATGG + Intronic
1197325793 X:125091697-125091719 CACCATGCCCGGCCTCTCCTAGG - Intergenic
1197443240 X:126515394-126515416 CACCATCCATACCCTGTCCAGGG - Intergenic
1198047499 X:132917308-132917330 CACCATGCCCAGCCTCAACATGG - Intronic
1198803626 X:140472290-140472312 CACCATGCCTGGCCTCAACATGG + Intergenic
1198850020 X:140956265-140956287 CACCATGCTTAGCAGCTCCTAGG - Intergenic
1200806861 Y:7442592-7442614 CACTGAGCATAGCCTCTTCAAGG - Intergenic
1201512678 Y:14782481-14782503 CACCATGCATAGCTTCTCCATGG - Intronic
1201860717 Y:18594520-18594542 CACCTTGAATAGCCTCTCGGGGG + Intergenic
1201872606 Y:18725860-18725882 CACCTTGAATAGCCTCTCGGGGG - Intergenic
1202108488 Y:21395919-21395941 CAGTATGCATAGCCTCTAGATGG + Intergenic