ID: 1186083920

View in Genome Browser
Species Human (GRCh38)
Location X:5965375-5965397
Sequence GTAACCAATGTGGCCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186083917_1186083920 -9 Left 1186083917 X:5965361-5965383 CCATGCACAAGTGTGTAACCAAT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1186083920 X:5965375-5965397 GTAACCAATGTGGCCAAGTTGGG 0: 1
1: 0
2: 1
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186083920 Original CRISPR GTAACCAATGTGGCCAAGTT GGG Intronic
902844807 1:19101648-19101670 GAAATCAAAGCGGCCAAGTTAGG + Intronic
903173859 1:21569357-21569379 ATACCCAATGTGGCCAGGCTCGG - Intronic
905688464 1:39925772-39925794 CTAACCAGTGGGGCCCAGTTGGG - Intergenic
907227996 1:52967356-52967378 ATATCCAATGGGGCCAATTTTGG + Intronic
908293829 1:62693367-62693389 GTTACCACTGTGGGCAATTTAGG + Intergenic
909115730 1:71533422-71533444 GTCCTCTATGTGGCCAAGTTTGG - Intronic
912628381 1:111225411-111225433 GTAAGGAATGTCTCCAAGTTAGG + Intronic
915622530 1:157094580-157094602 CCAACCAATGTGACTAAGTTGGG - Intronic
915747383 1:158173948-158173970 GAAACCAATCTGTTCAAGTTGGG + Intergenic
917647432 1:177043019-177043041 TTAACCAATATGGCCAAGGAGGG + Intronic
921605853 1:217153818-217153840 GTAAAGAAGGTGGCCAAGATGGG - Intergenic
922766569 1:228159257-228159279 GTCACCACTGGGGCCAAGGTGGG + Exonic
923944459 1:238867275-238867297 GTAACCAATGCAGAAAAGTTTGG + Intergenic
924250548 1:242128734-242128756 GAGACCAATATGGCCTAGTTAGG + Intronic
1062781256 10:210870-210892 GTAACAGATGTGGCCAGGTGTGG + Intronic
1064835697 10:19527438-19527460 TTAACCAATTTTGCAAAGTTAGG - Intronic
1065517699 10:26541377-26541399 GAAACTGATATGGCCAAGTTGGG - Intronic
1065918089 10:30368756-30368778 GTTAGCAGTGAGGCCAAGTTTGG - Intronic
1067981745 10:51094711-51094733 GAAACCCTTGTGGCCAAATTAGG + Intronic
1071618847 10:87099708-87099730 GTAGCCACTGTGGAAAAGTTTGG - Intronic
1075483698 10:122802727-122802749 GAAACCAATGTGAGGAAGTTTGG + Intergenic
1077897178 11:6461988-6462010 GAAACCAGTGTGGCCAAGTGAGG - Intronic
1080852483 11:36081828-36081850 GTGACCAATGTGGACAAGTTTGG - Intronic
1081469374 11:43355765-43355787 GTACCCAATGTGGCAGTGTTGGG + Intergenic
1081753169 11:45526567-45526589 GCATCCCATGTGGGCAAGTTTGG + Intergenic
1082667554 11:55992372-55992394 GTAACCACTGTGGTCCAGTAAGG + Intergenic
1084068682 11:66720139-66720161 GTAAAACATGTGGCCAGGTTTGG + Intronic
1087576121 11:99991875-99991897 GTAATCAAACTGGCCAAGGTTGG + Intronic
1087799004 11:102483839-102483861 TTAGTTAATGTGGCCAAGTTTGG - Intronic
1089429608 11:118411869-118411891 AAAACTAATGTGGCCAAGTGCGG + Intronic
1094272304 12:28630233-28630255 GAAACCATTTTGGCCAAGGTGGG + Intergenic
1097865660 12:64557327-64557349 GGAACCCATGTGACCCAGTTGGG - Intergenic
1100247745 12:92780522-92780544 GTAAGTAATTTGCCCAAGTTAGG - Intronic
1104538238 12:129638843-129638865 GAAAGCAATGTGGCCACCTTTGG - Intronic
1119350876 14:73964391-73964413 GTAACCAATTTGTCCATCTTAGG - Exonic
1119628193 14:76201549-76201571 GTAACCCAAGTGGCCACGTAAGG - Intronic
1120212439 14:81646753-81646775 GGAATGAATGTGGCCCAGTTTGG - Intergenic
1124881580 15:33647678-33647700 GTATCCAATGATGCCCAGTTAGG - Intronic
1129475570 15:75782704-75782726 GTTAGCAGTGAGGCCAAGTTTGG + Intergenic
1130928500 15:88403130-88403152 TTAATCATTCTGGCCAAGTTAGG + Intergenic
1132329711 15:101003846-101003868 GTGACCAAAGGGGCCAAGATGGG - Intronic
1136589683 16:31210337-31210359 GTTTCCAATATTGCCAAGTTGGG - Intergenic
1138090220 16:54167787-54167809 GTAGCCATGGTGGACAAGTTGGG + Intergenic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1166430407 19:42721357-42721379 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1166451113 19:42901801-42901823 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1166469274 19:43063924-43063946 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1166490225 19:43253001-43253023 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1168624623 19:57907622-57907644 GTAACCACTGTTCCCAAATTGGG - Exonic
927026622 2:19074682-19074704 GTCATAAATGTTGCCAAGTTTGG - Intergenic
931059071 2:58505905-58505927 GTAATCACTGTGGCCAAGGGAGG + Intergenic
933799309 2:85947575-85947597 GTTACCAATGTGGACAACTAGGG - Intergenic
940427362 2:153545655-153545677 GTGACCCCTGTGGCCAAGTGGGG - Intergenic
941195839 2:162450738-162450760 GGAATCAAGGTGGCCAAGTTTGG + Intronic
943142514 2:184000344-184000366 GTAATTACAGTGGCCAAGTTTGG - Intergenic
943843207 2:192605291-192605313 GTAGCCAACTTGGCCAAGATTGG - Intergenic
947380476 2:229540522-229540544 ATAGCCCATGTGGCCAAGTTGGG - Intronic
948366702 2:237459878-237459900 TTGACCAATGTGGCCAATTTTGG - Intergenic
1169547620 20:6666760-6666782 GTATCCTTTGTGGCCAAATTGGG - Intergenic
1173175560 20:40762366-40762388 GTAACTTATGTGACCAATTTTGG + Intergenic
1173392215 20:42645412-42645434 GTTACCATTGTGGCCAACTGTGG - Intronic
1173799920 20:45888674-45888696 GGCAGCAATGTGGCCAACTTCGG + Exonic
1184655403 22:45939207-45939229 GCAGCCACTGTGGCAAAGTTGGG + Intronic
952231434 3:31435023-31435045 GTAACAAATGACCCCAAGTTTGG + Intergenic
953070553 3:39515347-39515369 ATAAACAATGTAGCTAAGTTTGG - Exonic
955720552 3:61875894-61875916 GAAACCAGTGAGGCCCAGTTGGG - Intronic
955880153 3:63534946-63534968 ATACCCAATGTGGCAATGTTGGG - Intronic
963439606 3:145321235-145321257 CTAGCCAGTGTGGCTAAGTTTGG - Intergenic
963959924 3:151298306-151298328 GTAAAGAACTTGGCCAAGTTAGG + Intronic
966358827 3:179111509-179111531 TTAAAAAATGTGACCAAGTTTGG + Intergenic
968183651 3:196615920-196615942 ATAACCCATGTGGCCAGGTGCGG - Intergenic
969504717 4:7578022-7578044 GTGACCAAAGTGGCCATGTTGGG + Intronic
971539099 4:27792651-27792673 CTAACCATTGTGGCCAAATCTGG + Intergenic
977370977 4:96135752-96135774 GTAACCAATGTGGCAACTATTGG - Intergenic
978967041 4:114752886-114752908 AAAGCCAATGTGGCCAAGATGGG - Intergenic
981563760 4:146076038-146076060 GATTCCAATGTGGCCAGGTTTGG - Intergenic
981575146 4:146196531-146196553 TTAAGCAATGTGCCCAAGGTTGG - Intronic
981946487 4:150350737-150350759 GTTACAAATGTGACCAAGATAGG - Intronic
986337054 5:6763070-6763092 GTCTCCCATGTGGCCAGGTTGGG + Intergenic
988122865 5:26990757-26990779 GTAACCAGTGTGGTCAACTAAGG - Intronic
988239036 5:28584624-28584646 GTAACCTCTGTGGAAAAGTTTGG + Intergenic
990340068 5:54813428-54813450 GTAAACAAAGTGGCCAGGCTGGG + Intergenic
991511724 5:67385106-67385128 GTCAGCCATGTGGACAAGTTTGG - Intergenic
992818969 5:80475157-80475179 TTACCCAGTGGGGCCAAGTTTGG + Intronic
994906577 5:105846691-105846713 CTATCCTTTGTGGCCAAGTTGGG - Intergenic
1000073321 5:157761663-157761685 GTAATCAATGTGGCAAATCTGGG - Intergenic
1002956315 6:1868635-1868657 GTCACCAAAGTGGCATAGTTGGG + Intronic
1004224104 6:13770592-13770614 GAGACCAATCTGGCCAAGGTGGG - Intergenic
1004928470 6:20438724-20438746 ATAACCAATCTGGGCAATTTGGG + Intronic
1012749152 6:103135483-103135505 ATAATCAATGTGGGAAAGTTTGG - Intergenic
1017307392 6:152934907-152934929 GGAAAGAAAGTGGCCAAGTTAGG - Intergenic
1018730806 6:166649092-166649114 GTGACAAATGAGGCCACGTTTGG - Intronic
1020911325 7:14135546-14135568 GTTACTAATGTGGACAATTTGGG + Intergenic
1024468503 7:49740339-49740361 GTAACCACTGGGGCCAGGTGTGG + Intergenic
1027437286 7:78177266-78177288 GTACCCAATGTGACTAAGTTAGG - Intronic
1031026759 7:116687541-116687563 GTACAAAATGTGGCCAGGTTTGG + Intronic
1031047380 7:116907143-116907165 GTAACCCCTGTGGGCCAGTTGGG + Intronic
1031382224 7:121101291-121101313 GTAAACAATGTGGGGAAGTAAGG - Intronic
1037562368 8:20086642-20086664 GGAACCAAAGTGGCAAAGGTGGG - Intergenic
1050566240 9:6886906-6886928 GTGACCAATTTGGCCAGGTACGG - Intronic
1052548229 9:29908575-29908597 TTAACCAAGGTTGCCACGTTTGG + Intergenic
1057953312 9:99387010-99387032 GTCACCAACCTGGCCAACTTTGG - Intergenic
1060393130 9:123295733-123295755 GAAACCTATGTGTCCAAGTTAGG - Intergenic
1186061422 X:5711950-5711972 CTAACCAATTTGGAAAAGTTTGG + Intergenic
1186083920 X:5965375-5965397 GTAACCAATGTGGCCAAGTTGGG + Intronic
1186895544 X:14001433-14001455 ATAATCAATTTGTCCAAGTTAGG + Intergenic
1187407347 X:19015833-19015855 GCAACCCACCTGGCCAAGTTGGG + Intronic
1187823550 X:23312886-23312908 GTAACCAATATGGCTAAGGTCGG + Intergenic
1191729137 X:64314902-64314924 CAAACCAATGTGGCCAGGCTGGG + Intronic
1192247742 X:69387658-69387680 GGTACCAATCTGGCCAACTTAGG + Intergenic
1195133668 X:101880752-101880774 ATAACAAATGTGCCAAAGTTGGG + Intergenic
1196258342 X:113548890-113548912 GTAATCAGTGTGTCCATGTTGGG + Intergenic
1197995478 X:132368097-132368119 GTAAACATTGAGGCCAAGTTGGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic