ID: 1186088329

View in Genome Browser
Species Human (GRCh38)
Location X:6015742-6015764
Sequence CATTGTATGGAGACAATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186088329_1186088336 10 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088336 X:6015775-6015797 CACAAGGGACGGGATAGCAGTGG 0: 1
1: 0
2: 1
3: 9
4: 104
1186088329_1186088332 -5 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088332 X:6015760-6015782 CAATGATGAGACAGCCACAAGGG 0: 1
1: 0
2: 0
3: 21
4: 207
1186088329_1186088334 0 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088334 X:6015765-6015787 ATGAGACAGCCACAAGGGACGGG 0: 1
1: 0
2: 0
3: 32
4: 252
1186088329_1186088337 29 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088337 X:6015794-6015816 GTGGACTGTCACGATAACCATGG 0: 1
1: 0
2: 0
3: 3
4: 32
1186088329_1186088333 -1 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088333 X:6015764-6015786 GATGAGACAGCCACAAGGGACGG 0: 1
1: 0
2: 5
3: 34
4: 341
1186088329_1186088331 -6 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088331 X:6015759-6015781 ACAATGATGAGACAGCCACAAGG 0: 1
1: 1
2: 3
3: 28
4: 239
1186088329_1186088338 30 Left 1186088329 X:6015742-6015764 CCTTATATTGTCTCCATACAATG 0: 1
1: 0
2: 2
3: 7
4: 164
Right 1186088338 X:6015795-6015817 TGGACTGTCACGATAACCATGGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186088329 Original CRISPR CATTGTATGGAGACAATATA AGG (reversed) Intronic
901285455 1:8075139-8075161 CATTTTCTGGATACAATATCTGG - Intergenic
902276097 1:15340620-15340642 CAGTGTCTGGAGGCAAAATATGG + Intronic
907088148 1:51697830-51697852 GTTTATATGGAAACAATATAAGG - Intronic
907538543 1:55189297-55189319 CATTGTATGGATATAACACATGG - Intronic
908144386 1:61223424-61223446 CTTTGCAAGGAGACAAAATATGG + Intronic
910409737 1:86927937-86927959 CATTGTCTGAAGACAAGCTATGG - Intronic
911707191 1:101027015-101027037 ACTTGTATGGAGAATATATAAGG + Intergenic
918728811 1:187962569-187962591 CATTGTATGTACACAATATATGG - Intergenic
919292441 1:195649718-195649740 CATAATTTGGAGAAAATATAAGG + Intergenic
920131651 1:203736738-203736760 CAGTGTATGGGGACAAGACAGGG - Intronic
921342547 1:214148575-214148597 GATTGTGTGTAGACAATATCAGG - Intergenic
922638292 1:227199599-227199621 TAGTGAATGGAGACAATAAATGG - Exonic
922751186 1:228070735-228070757 CAGTGTATGGAGATAGTGTAGGG + Intergenic
923334318 1:232953791-232953813 CAATGTATGAAAATAATATATGG - Intronic
924478328 1:244402171-244402193 CATTGCTTGGAAACATTATAAGG - Intergenic
1063587552 10:7366229-7366251 CTTTCTTTGGAGACAATAAAGGG + Intronic
1066211616 10:33245280-33245302 CAATGTCTGGAGACAGTATTTGG + Intronic
1068398241 10:56492517-56492539 CATTGAATGCCTACAATATATGG - Intergenic
1068694877 10:59956956-59956978 CCTTGTATGCAGACAGTAAAAGG - Exonic
1071102914 10:82060263-82060285 CAATGTAGGTACACAATATATGG + Intronic
1078279392 11:9884885-9884907 CATTTCATGGAAACAATCTAAGG + Intronic
1079639179 11:22782787-22782809 CATGGTACGTAGACACTATACGG - Intronic
1081071079 11:38608980-38609002 TATTGTATTGACACAATTTAAGG - Intergenic
1082866471 11:57904140-57904162 CATGGGAAGGAGACAATTTATGG + Intergenic
1082893838 11:58169009-58169031 CATTGTCTGACCACAATATAAGG - Intronic
1083209591 11:61174805-61174827 CACTGTATGGAGACAAAGAATGG - Intergenic
1085780812 11:79407043-79407065 CAGTGTATGGGGCCAATATTTGG + Intronic
1088593271 11:111421312-111421334 CTTTGTATGGAGGCAACATTAGG - Intronic
1091686948 12:2569328-2569350 CATTGTAAGGGGTAAATATATGG - Intronic
1093102407 12:15043395-15043417 CATTATATGAAGAAAAAATAAGG - Intergenic
1095195722 12:39313799-39313821 CATTCTATGTAGGCCATATATGG + Intronic
1098856791 12:75661981-75662003 CATTGTGTGCAGTCAATAAATGG + Intergenic
1099283826 12:80689510-80689532 CATTGTATGTATACAACTTAAGG - Intergenic
1099431551 12:82592138-82592160 CATTGTATGGTGACCAGATTGGG - Intergenic
1100978528 12:100146221-100146243 CTTTCTATGGATACAAGATAGGG + Intergenic
1101551421 12:105765966-105765988 CACTGAATGTAGACTATATAAGG + Intergenic
1101895143 12:108750853-108750875 CAGTGTCTGGAGACAGTATTTGG + Intergenic
1103670565 12:122611492-122611514 CTTTATATGTAGAGAATATAAGG - Intronic
1104067555 12:125317978-125318000 CATTGTATGGAAATACCATATGG - Intronic
1104291131 12:127469294-127469316 CATGGTATGGAGAAAATAACTGG + Intergenic
1106956755 13:34947546-34947568 CATTGTATAAAGACAAGAAATGG - Intronic
1107044967 13:35984368-35984390 CATTGTTTGGAGACAACACTGGG + Intronic
1109050215 13:57470969-57470991 CATGGTATGGAGATAATAAAGGG - Intergenic
1109059380 13:57594330-57594352 TATTGTATAGAGAAAATATGAGG - Intergenic
1109458573 13:62625724-62625746 CTTTTTATGGACACAAGATAGGG + Intergenic
1109636567 13:65125774-65125796 AATTTTATGGAGATAATTTAGGG - Intergenic
1110172602 13:72520151-72520173 AGTAGTATGGAGACAATGTATGG - Intergenic
1110235112 13:73209676-73209698 CATTGGATGGAGGCAAGATTAGG - Intergenic
1111839444 13:93431371-93431393 GATTTTATGGAGACATCATATGG - Intronic
1114700003 14:24667210-24667232 CATTTTATTAAGACAATGTATGG - Intergenic
1114942876 14:27637808-27637830 CATTTTATAGAGTCAATATTTGG - Intergenic
1117924781 14:60766952-60766974 GATAATATGGAGAAAATATAAGG + Intronic
1119812831 14:77537840-77537862 CATGGTAAGCAGACAATAAACGG + Intronic
1122102409 14:99423899-99423921 CATTTAATGAAGAAAATATAAGG - Intronic
1123927005 15:25124837-25124859 AAATGAATAGAGACAATATAGGG - Intergenic
1124882220 15:33653050-33653072 CATTGTATGCAGAGAAAAAAAGG + Intronic
1128194270 15:65736788-65736810 GATTGAATGCAGACCATATATGG + Intronic
1133594886 16:7281565-7281587 CATTGTCTGGGCACAATATCTGG + Intronic
1140960174 16:79904140-79904162 CAATGTCTGCAGACATTATAGGG + Intergenic
1143639470 17:8187854-8187876 CATCTTATGGCCACAATATATGG + Intergenic
1145047954 17:19633770-19633792 CAATGTATGCTGACAATATTTGG + Intergenic
1146803825 17:35849244-35849266 TAGTTTTTGGAGACAATATATGG + Intronic
1147887446 17:43693655-43693677 CAATGTCTGGAGACATTTTACGG - Intergenic
1149676276 17:58465321-58465343 CTTGTTATAGAGACAATATATGG - Intronic
1155161472 18:23199476-23199498 CATTGTATGGATACAGCACATGG - Intronic
1157055924 18:44228805-44228827 GATTGTATGTAGATCATATAGGG - Intergenic
1157292024 18:46416437-46416459 TGTTGCATGGAGACAATACAGGG + Intronic
1158486227 18:57868428-57868450 TATGGTATGGAGACAAGGTAAGG + Intergenic
1158750973 18:60260501-60260523 CTTTGTATGGATATATTATAAGG + Intergenic
1159593484 18:70360132-70360154 CAATATATGGAGTCCATATATGG + Intergenic
1164593817 19:29520667-29520689 CATTGCATGGAGACAAGAGAGGG - Intergenic
933377255 2:81495753-81495775 CTTGGTAGGGAGACATTATAAGG - Intergenic
933452145 2:82468147-82468169 TATTTTATGAAGACTATATATGG + Intergenic
934767705 2:96889227-96889249 CATTGTATGGAAAGAAACTAAGG - Intronic
935834024 2:107030553-107030575 CATTGTTTGCAGAAAATCTATGG + Intergenic
939648329 2:144729921-144729943 AATTGTAAGCAGACTATATAAGG - Intergenic
941785463 2:169493168-169493190 CATTGTATTGAAAGAAAATAGGG - Intronic
944944439 2:204667009-204667031 CATTGAATGGTGTGAATATAAGG + Intronic
945847903 2:214969233-214969255 TAATGTCTGGGGACAATATAGGG - Intronic
948316705 2:237032721-237032743 TATTGTGTGTAGACTATATATGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1174960093 20:55146512-55146534 CTTTGTGTGGACAAAATATAAGG + Intergenic
1176691317 21:9913976-9913998 CATTTTATGGACACAGTGTAGGG - Intergenic
1177233679 21:18357478-18357500 GATTATATAGAGACAATGTAAGG - Intronic
1177606711 21:23388526-23388548 CATTATATCAAGAAAATATAAGG + Intergenic
1177617858 21:23547933-23547955 CATTTTAAGAAGACAATCTATGG + Intergenic
953262634 3:41354522-41354544 CATTGTATGACAACAATATATGG + Intronic
953679341 3:45028001-45028023 CCTTCTATGGAGACCACATAGGG - Intronic
954852288 3:53613772-53613794 CCTTGTATCAATACAATATAAGG - Intronic
956026663 3:64989653-64989675 CATTGTAGTGAGACAATGTCTGG - Intergenic
959200776 3:103243894-103243916 GATTGGATGGAGAGAATATTAGG - Intergenic
963024189 3:140901721-140901743 AATTAAATGGAGACCATATATGG - Intergenic
963031087 3:140977427-140977449 CATTTTAAGGTGACAATATTTGG + Intronic
963182727 3:142376697-142376719 CATTGGATTGTGGCAATATAAGG + Intronic
963766980 3:149347548-149347570 TATGGCATGGAGACAGTATAAGG + Intergenic
964012507 3:151907881-151907903 CATTAGAAGGAGACAAAATAGGG + Intergenic
965750124 3:171967031-171967053 CAATGTCTGGAATCAATATAGGG - Intergenic
966226002 3:177598731-177598753 CATTGACTGGAGAGAAAATAGGG - Intergenic
968326697 3:197823889-197823911 CATGGTATGGTGACAGTGTAAGG - Intronic
970090969 4:12407519-12407541 CGTTGCATGAAGACCATATATGG + Intergenic
972271416 4:37513771-37513793 AATTGTGTGGAGACTAAATAAGG + Intronic
973028576 4:45305953-45305975 CTTTATTTGGAGACTATATATGG + Intergenic
976481131 4:85547122-85547144 CAGAGAAAGGAGACAATATAGGG - Intronic
980363905 4:131774163-131774185 CATTTTATGGACACAGTGTAGGG - Intergenic
981205443 4:142034670-142034692 CCTTGTATCCAGACCATATATGG + Intronic
987143915 5:14972890-14972912 CACTGAATGGAGAAATTATAAGG - Intergenic
988730310 5:33966153-33966175 TATTTTATGGAAAAAATATAAGG + Intronic
989418055 5:41203804-41203826 CATTTTATGGAGATAAAATGAGG + Intronic
989509634 5:42270241-42270263 CATTTTCTGGATACTATATAGGG - Intergenic
993129838 5:83881735-83881757 AACTGTATGGAAAAAATATAAGG + Intergenic
995009843 5:107245099-107245121 CAATGTAGGAAGATAATATAAGG + Intergenic
995219156 5:109628475-109628497 CACTGTTTGTAGACAATTTAGGG - Intergenic
995227616 5:109720149-109720171 CAGTGTGTGGAGAGAAGATAAGG + Intronic
997902280 5:137777913-137777935 CCTTGAATGGAGAGAATATTTGG - Intergenic
998950355 5:147387610-147387632 GATTTTATGTAGACAATACAGGG - Exonic
998959923 5:147474621-147474643 GATTGTATGGAGATTACATAGGG + Intronic
1000452532 5:161407707-161407729 CATTCTATGTAGACAAAATATGG + Intronic
1000477053 5:161723523-161723545 CTTTGTATGGAGACATTCTGTGG - Intergenic
1002125641 5:177041820-177041842 CATGGAATGGAGACATTAAAGGG + Exonic
1002952523 6:1828987-1829009 CATTGTAAGAATACAGTATATGG - Intronic
1009922248 6:70076474-70076496 CAATGTGTGGAGACCATAAAGGG - Intronic
1010120708 6:72372757-72372779 CATTGTTGGGAAACTATATATGG + Intronic
1011049932 6:83134988-83135010 CATTGTAGGGGTTCAATATATGG - Intronic
1013148546 6:107420418-107420440 CGATGTAGTGAGACAATATAAGG - Intronic
1013538620 6:111086495-111086517 CAGTGTTTGGAGAGAATTTAAGG + Intergenic
1013574769 6:111471039-111471061 GAATGTATGTAGAAAATATATGG + Intronic
1014987974 6:128035471-128035493 CATGGTAATGATACAATATAAGG + Intronic
1017583011 6:155887645-155887667 CATGGAATGGAGCCACTATAAGG - Intergenic
1020498494 7:8887374-8887396 CATGGTAAGAAGAAAATATAGGG + Intergenic
1021900933 7:25284929-25284951 CATTATAAGGAGACATTATCAGG - Intergenic
1021913960 7:25413194-25413216 CATTGGATGTAGAAAAGATATGG + Intergenic
1027695007 7:81399413-81399435 CATTGTATGTTGAGTATATAGGG - Intergenic
1027858248 7:83540480-83540502 CATTCTAGGGACATAATATATGG - Intronic
1027976666 7:85165801-85165823 CCTTTTATGGAGAAAATATGTGG + Intronic
1028577863 7:92372114-92372136 AATTGTATGGAGACAGTATATGG - Intronic
1030593908 7:111513164-111513186 CATGGTAAAGAGACAATCTATGG + Intronic
1032925209 7:136596534-136596556 TATTATATGGAGACAGCATAGGG + Intergenic
1033668905 7:143470728-143470750 AATTCTATGAAGACAATAGAAGG - Intergenic
1035909154 8:3546552-3546574 CAATGTATGGTGACAGTATCAGG - Intronic
1036069062 8:5420114-5420136 CATTTCATGGAGACGATAAACGG - Intergenic
1036108795 8:5875472-5875494 CATGGTATTGAGACAATCTGAGG - Intergenic
1036668968 8:10767248-10767270 CACTGTGTCGAGACAATACAGGG - Intronic
1040064963 8:43138326-43138348 CATAGTATGGAGACACAATTAGG - Intergenic
1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG + Intergenic
1042285128 8:67101113-67101135 CATTGAATTGTAACAATATAAGG + Intronic
1043348076 8:79323414-79323436 AATTCTATGGAGAGAAAATAAGG - Intergenic
1046321656 8:112585137-112585159 CACTCTATAGAGACAATTTAGGG - Intronic
1047681843 8:127261828-127261850 CAGTGTATAGAGACAACCTATGG - Intergenic
1048356170 8:133655757-133655779 CAGTATCTGGAGACAACATATGG + Intergenic
1052647052 9:31250118-31250140 CATTGTATTGTAACAACATATGG - Intergenic
1053628249 9:39900047-39900069 CATTTTATGGACACAGTGTAGGG - Intergenic
1054215638 9:62350654-62350676 CATTTTATGGACACAGTGTAGGG + Intergenic
1054364243 9:64316143-64316165 CATTTTATGGACACAGTGTAGGG - Intergenic
1054671843 9:67804696-67804718 CATTTTATGGACACAGTGTAGGG - Intergenic
1054866648 9:70009348-70009370 CATTTTAGGGATACAATACAAGG + Intergenic
1055071133 9:72167188-72167210 CATTGTCTGGATGCAATATCTGG - Intronic
1055216611 9:73871465-73871487 CTTTGTATTCAGATAATATAAGG - Intergenic
1055590560 9:77808803-77808825 CGTTGTATGGTGAAAATATTAGG - Intronic
1058140471 9:101352561-101352583 AATGGAATGGAGAAAATATAGGG + Intergenic
1059069735 9:111122799-111122821 TATTGATTGTAGACAATATATGG + Intergenic
1059188321 9:112298011-112298033 CTTTGTATGAAGACATTAAAGGG + Intronic
1059544165 9:115159666-115159688 CATTTTATGGAGCCGATGTAAGG + Intronic
1186088329 X:6015742-6015764 CATTGTATGGAGACAATATAAGG - Intronic
1186523049 X:10222535-10222557 CAATGTCTGGAGACAATTTGGGG + Intronic
1191663973 X:63679029-63679051 CATTTTATGGAGATAATATCAGG - Intronic
1191744055 X:64466273-64466295 CAGTGTATGGAAACAATGTAAGG + Intergenic
1193260483 X:79400800-79400822 CATTCAATGAAGACAATAAAAGG + Intergenic
1193367043 X:80647079-80647101 TATAGTATGGAGACAGTATTGGG - Intergenic
1194149322 X:90303914-90303936 AATTGTATGGTGGCTATATAGGG - Intergenic
1196108715 X:111923515-111923537 TATTTTATGAAGAAAATATATGG - Intronic
1196522658 X:116692593-116692615 TAATTTATGGAGACAATTTATGG + Intergenic
1196740310 X:119019230-119019252 CAATGTATGGGGAGAATATAGGG + Intergenic
1197283077 X:124561052-124561074 CATAGCATCGAGACAATTTATGG - Intronic
1200495697 Y:3880644-3880666 AATTGTATGGTGGCTATATAGGG - Intergenic