ID: 1186088628

View in Genome Browser
Species Human (GRCh38)
Location X:6019734-6019756
Sequence CTTCTCATCCAGTATGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186088628_1186088630 10 Left 1186088628 X:6019734-6019756 CCTTTCACATACTGGATGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1186088630 X:6019767-6019789 AAAACAGGCTGAAGAGAGAAAGG 0: 1
1: 0
2: 6
3: 80
4: 686
1186088628_1186088631 11 Left 1186088628 X:6019734-6019756 CCTTTCACATACTGGATGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1186088631 X:6019768-6019790 AAACAGGCTGAAGAGAGAAAGGG 0: 1
1: 0
2: 14
3: 91
4: 836
1186088628_1186088632 15 Left 1186088628 X:6019734-6019756 CCTTTCACATACTGGATGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1186088632 X:6019772-6019794 AGGCTGAAGAGAGAAAGGGATGG 0: 1
1: 1
2: 10
3: 188
4: 1748
1186088628_1186088629 -5 Left 1186088628 X:6019734-6019756 CCTTTCACATACTGGATGAGAAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1186088629 X:6019752-6019774 AGAAGCAAAATGAAGAAAACAGG 0: 1
1: 1
2: 16
3: 203
4: 2326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186088628 Original CRISPR CTTCTCATCCAGTATGTGAA AGG (reversed) Intronic
900298402 1:1964418-1964440 CTTCTCTTCCAGGAGGTGGAGGG - Intronic
900384409 1:2403059-2403081 CTTCTCTTCCCATGTGTGAACGG - Exonic
901301792 1:8204970-8204992 CTTCTCATCAAAGATGTGATTGG - Intergenic
901435001 1:9242071-9242093 ATTCTGATCCAGTAGGTGTAGGG - Intronic
904153926 1:28466475-28466497 CTTCTCATGAAGCAAGTGAAGGG + Exonic
904855745 1:33497086-33497108 CTTCACATCCACTATCTGATAGG - Intergenic
906014146 1:42558799-42558821 CTTCTCATGGAGTATCTTAATGG - Intronic
908398751 1:63750467-63750489 TTCCTCAGCCAGTTTGTGAAAGG - Intergenic
911538498 1:99129593-99129615 CTTCTCATGCAGTATCTTACTGG + Intergenic
913454582 1:119018297-119018319 CTTCTCATTCAGTAGGTGTGGGG + Intergenic
917793699 1:178516452-178516474 CTTCTCAAGGAGTCTGTGAAGGG - Intronic
918876470 1:190051743-190051765 GTTGTCCTCCAGTAGGTGAATGG - Intergenic
918878880 1:190087425-190087447 CTTTTCTTCCCGTCTGTGAATGG - Intergenic
921328051 1:214007290-214007312 CTTCTCTTCCAGTATGGGTAAGG - Intronic
921736248 1:218632270-218632292 CTTCTCATGGAGTATCTTAATGG + Intergenic
923128954 1:231058080-231058102 CTCCTGATCCAGAATGTGAATGG + Intergenic
1064411025 10:15104183-15104205 CATGTCATACAGTTTGTGAAAGG + Exonic
1064486504 10:15797968-15797990 CTTCTCAGCCAGAATTTCAAAGG - Intronic
1064565658 10:16636448-16636470 CTTCTCATCCTGTCTGTGGTTGG + Intronic
1065814205 10:29469960-29469982 CTTCTCATCCAAAAGCTGAACGG + Intronic
1068126711 10:52850101-52850123 CTTCTCATGGAGTATCTTAATGG + Intergenic
1079426233 11:20344327-20344349 CTTCTCATGGAGTATCTGAGTGG - Intergenic
1079580189 11:22054634-22054656 CTTCTCATGGAGTATGTTACTGG + Intergenic
1081454787 11:43211183-43211205 CTTCTCATGGAGTATCTTAATGG + Intergenic
1082580664 11:54863819-54863841 GTTTTCATCCATTCTGTGAAAGG - Intergenic
1082720355 11:56667636-56667658 CTTTTCAGCCAGTATGTTGAAGG - Intergenic
1083246656 11:61433663-61433685 ATTCTCATCCAGAATGTTTATGG + Intronic
1084762033 11:71280064-71280086 TTTAGCATCCAGGATGTGAAAGG + Intergenic
1084904778 11:72337063-72337085 CTTCACATCCAGTATGTATGGGG + Intronic
1085261987 11:75211328-75211350 CTTCTCAACCAGGCTGTGATAGG - Intergenic
1088005005 11:104928729-104928751 CTTCTCATGGAGTATCTTAATGG - Intergenic
1091134727 11:133178558-133178580 CTTCTCATCCAGCTAGAGAAAGG + Intronic
1092850676 12:12623812-12623834 CTTATCCTCCATTATGTGGATGG + Intronic
1093504787 12:19852805-19852827 CTTGGCTTCCAGTCTGTGAAGGG - Intergenic
1093522668 12:20068427-20068449 CTTCTCATGGAGTATCTTAATGG - Intergenic
1094328981 12:29272120-29272142 CTTCTCATGGAGTATCTTAATGG + Intronic
1094776220 12:33731085-33731107 CTTCTCATGGAGTATCTTAATGG + Intergenic
1094866358 12:34536077-34536099 CTTTTTATCCATTCTGTGAATGG - Intergenic
1095302304 12:40598765-40598787 CTGCTAATCCAATATCTGAAAGG + Intergenic
1097583108 12:61482388-61482410 CTTCTCATGGAGTATCTGACTGG - Intergenic
1098941984 12:76548608-76548630 CATCTCATCCAGCATTTAAAGGG + Intronic
1101371134 12:104131946-104131968 GTTCTCATCCAGTTTGTTCACGG - Intronic
1105569702 13:21590094-21590116 CTTCTCATGGAGTATCTTAATGG - Intronic
1108052955 13:46463933-46463955 CGTCTTATCCAGAGTGTGAAAGG - Intergenic
1108160581 13:47633976-47633998 CTTCTCATGGAGTATCTTAACGG - Intergenic
1109097067 13:58132598-58132620 CTTCTCATAGAGTATCTTAAAGG + Intergenic
1110789253 13:79569200-79569222 GTTCTCACCAAATATGTGAAAGG - Intergenic
1111196039 13:84875217-84875239 CTTTTGATCCATTATGTGCAGGG - Intergenic
1111326742 13:86707296-86707318 TTTTTCTTCCAGTATGTTAAAGG + Intergenic
1111829792 13:93313315-93313337 CTTCCAATCTAGTATTTGAATGG + Intronic
1114706139 14:24728171-24728193 CTTCTCATGTAGTATCTTAATGG - Intergenic
1116977575 14:51132825-51132847 CTTCTCATGGAGTATCTTAATGG - Intergenic
1117189694 14:53277883-53277905 GTTCTCACCCTGTATGTGGAGGG - Intergenic
1202840019 14_GL000009v2_random:113091-113113 CTTCTCTTCCCTTATGTGTATGG - Intergenic
1202909402 14_GL000194v1_random:103288-103310 CTTCTCTTCCCTTATGTGTATGG - Intergenic
1125903151 15:43367821-43367843 CTTCTCAGCCAGTTTGGTAATGG - Intronic
1131951106 15:97682913-97682935 CTTCTGCTCCAGCATTTGAAGGG - Intergenic
1133845654 16:9451201-9451223 CTTCACCTCCATTATGTAAATGG - Intergenic
1134275181 16:12769652-12769674 CTTCACATCCAGTATGAGCCCGG - Intronic
1135420404 16:22302029-22302051 CTTCTCTTTGGGTATGTGAAGGG + Intronic
1136545843 16:30954178-30954200 CTTCACATCCTGTATAGGAATGG - Exonic
1140916764 16:79500813-79500835 TGTCTCATCCAGTAAGTGAGAGG - Intergenic
1141014684 16:80437926-80437948 CTTCTGATCCTGTAATTGAAGGG - Intergenic
1141134983 16:81459243-81459265 CTTGGCATCCAGGCTGTGAAGGG + Intronic
1146282098 17:31551273-31551295 CTTCTCATCAGGAATTTGAAGGG - Intergenic
1148487469 17:48000022-48000044 ATTCTCCTGCAGTATCTGAATGG - Intergenic
1149013885 17:51886110-51886132 ATGCCCATCCAGTAAGTGAAGGG + Intronic
1152602087 17:81268836-81268858 GTTCTTATTCAGTCTGTGAATGG - Intronic
1154328481 18:13409678-13409700 CTTCTCCTCCAGCTTGCGAATGG - Intronic
1154348110 18:13560671-13560693 CTTCTCAGCCTCTCTGTGAAAGG + Intronic
1157007735 18:43605928-43605950 CTTCTCATGAAGTATGTTACTGG + Intergenic
1159868824 18:73737554-73737576 CTTCTCCTTCAGTAGGTGAATGG - Intergenic
1160069599 18:75615022-75615044 CTTCACCACCAGTATGTGCACGG + Intergenic
1160561232 18:79757262-79757284 ATTATCTTCCAGTAGGTGAATGG - Intergenic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1202652846 1_KI270707v1_random:22581-22603 CTTCTCTTCCTTTATGTGTATGG - Intergenic
929030728 2:37648073-37648095 CTTATCATATAGTATGTGCAGGG - Intronic
932127980 2:69161838-69161860 CTTCTCATGCAGAATTTAAAAGG + Intronic
932152184 2:69383399-69383421 CTTCATATCCAGTATATGTAAGG + Intronic
932826910 2:74949353-74949375 CTTCTCATGGAGTATCTTAATGG - Intergenic
933419628 2:82029175-82029197 CTTTTGATCCATTATGTGTAGGG - Intergenic
933838890 2:86269584-86269606 CTTATAATCCAGTATGTAGATGG - Intronic
938559419 2:132458075-132458097 CGTCTCACCCAGGATGTGCAAGG - Intronic
939138840 2:138329016-138329038 CATATCATTCAGTAGGTGAATGG + Intergenic
940529608 2:154864290-154864312 CTGCTCTTGCAGTCTGTGAAGGG + Intergenic
943514208 2:188863902-188863924 CTTCTCATGCAGTATCTTAGTGG - Intergenic
944228749 2:197372691-197372713 CTTTTCATCCAGGGTGTGGAGGG + Intergenic
944319815 2:198326519-198326541 GTTCTCATCAACTATATGAATGG + Intronic
944726012 2:202471718-202471740 CTTCTCATCCAGTAAAAGACAGG - Intronic
945311483 2:208318607-208318629 ATTCTCATTCAGTAGGTTAAGGG + Intronic
946165519 2:217861280-217861302 CGTCTCATTCAGTATCTGAAGGG - Intronic
947556665 2:231099338-231099360 CTTCTAATCCGATATGTTAATGG - Intronic
947942902 2:234074331-234074353 CTTATCATCAACTATGTGGAAGG + Intronic
1170011636 20:11729650-11729672 CTTCTCATGGAGTATCTTAATGG - Intergenic
1171019967 20:21576090-21576112 CTTCCCATCCACTAAGTGCATGG - Intergenic
1173729249 20:45317135-45317157 CTTGTCTTCCTGTATGTGTAAGG - Exonic
1175058794 20:56222357-56222379 CTTCACATCCAGTATCTCACAGG + Intergenic
1176599304 21:8777070-8777092 CTTCTCTTCCCTTATGTGTATGG + Intergenic
1176987441 21:15454339-15454361 CTTCTCATGGAGTATGTTACTGG + Intergenic
1177835999 21:26186875-26186897 CTTGTCTTCAAGCATGTGAAAGG - Intergenic
1177878761 21:26668053-26668075 CTTCTCATGGAGTATCTTAATGG + Intergenic
1179547662 21:42123407-42123429 CCTCTCATCCTGTCTGTGCAGGG - Intronic
1181869548 22:25886909-25886931 CTTCTCATAAGGTATTTGAAGGG + Intronic
950793189 3:15489615-15489637 CTTCTGATCCAGGCTGGGAAGGG + Exonic
954838600 3:53493168-53493190 CTTCTGATCCAAAATCTGAAGGG - Intergenic
955536823 3:59932484-59932506 CTTCTCATCCAGACTAGGAAAGG + Intronic
955951976 3:64251582-64251604 CTTCTTGACCAATATGTGAAGGG - Intronic
956578472 3:70782271-70782293 CTTCTCAAGCAGCATTTGAAAGG - Intergenic
957431260 3:80110875-80110897 CTTGTCAGGCAGTATGAGAAAGG - Intergenic
958817360 3:98930313-98930335 CTTCTCATGGAGTATCTGACTGG - Intergenic
958883647 3:99701395-99701417 ATTCTCACCCATTATGTGTAGGG - Intronic
959418202 3:106103029-106103051 CTTCTCATGGAGTATCTTAATGG + Intergenic
962422118 3:135238006-135238028 CTTGTCTTCAATTATGTGAAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963416094 3:144997740-144997762 CTTCTCATGCAGTATCTTACTGG + Intergenic
964008132 3:151855897-151855919 CTTCTCATTCAGCATCTGATTGG + Intergenic
965263493 3:166512136-166512158 CTTCTCATGGAGTATCTTAATGG - Intergenic
966212401 3:177467188-177467210 TTTCTCTTCCATTCTGTGAATGG - Intergenic
966430646 3:179828342-179828364 TTTCTCATCCAGGATGAGAAGGG - Intronic
967695929 3:192530246-192530268 CGTCTCATCCAGTAAATGTAAGG - Intronic
968436990 4:598416-598438 CTTCTCATACAGTATCTTACTGG + Intergenic
970666330 4:18341732-18341754 CTTCTCATGGAGTATCTTAATGG + Intergenic
971014123 4:22469809-22469831 CATCTCATCCAGCATGAGCAAGG + Intronic
973173931 4:47180210-47180232 ATTCTCTTCCACTATGTGAATGG - Intronic
974985587 4:69021614-69021636 CTTTTCCTCCAATATGTGGAAGG - Intronic
975802722 4:78079076-78079098 CTTCTCATCTATTATCTTAATGG - Intronic
975924459 4:79432258-79432280 GTTCTCATCCAAAATGTGAGAGG - Intergenic
976584070 4:86775546-86775568 GATGTCATCCATTATGTGAACGG + Exonic
980119781 4:128715663-128715685 CTTCCCTTCCAGTGCGTGAAGGG - Intergenic
980219991 4:129901803-129901825 CTCCCAATCCAGTATGTGAGGGG - Intergenic
981481962 4:145247970-145247992 TTTCTCCACCAGTATGTCAAAGG - Intergenic
981549552 4:145929734-145929756 CTTATTATTAAGTATGTGAAAGG - Intronic
981631710 4:146826598-146826620 CTTCTCATGGAGTATCTTAATGG + Intronic
981672568 4:147303702-147303724 CTTCTCATCCAGTGACTGACAGG - Intergenic
983936533 4:173506706-173506728 CTTCAAATCCAGGAAGTGAAGGG - Intergenic
987399663 5:17462492-17462514 CTTCTCATGGAGTATCTTAATGG + Intergenic
987834541 5:23144920-23144942 CTTCTCATGGAGTATCTTAATGG + Intergenic
988059660 5:26150173-26150195 CTTCTCATAGAGTATCTTAATGG - Intergenic
989312535 5:40036987-40037009 TTTATCATCCAGAATGTGAAGGG + Intergenic
989450031 5:41575613-41575635 CCTCTCTTCCAGGCTGTGAAGGG - Intergenic
989723316 5:44555043-44555065 ATTTTCATCCTGTATGTGATAGG + Intergenic
990138915 5:52681161-52681183 CTTCTCATGGAGTATTTTAATGG + Intergenic
990610050 5:57447917-57447939 CCTCTCAACCACTATGTGTATGG + Intergenic
991433405 5:66571641-66571663 TTTCTGATCCAATATGTGTAAGG - Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
996006007 5:118421200-118421222 CTTCTCATGCAGTATTTTACTGG - Intergenic
1001788989 5:174438451-174438473 CTTCTCATGGAGTATCTTAATGG - Intergenic
1003223785 6:4186846-4186868 GTTCTCACCCAGTATGGTAAAGG + Intergenic
1003619941 6:7691024-7691046 CTTCTCCTGAAGCATGTGAATGG + Intergenic
1004722043 6:18276263-18276285 CTTCTCAACCAGTTTGTAACAGG - Intergenic
1006249295 6:32767003-32767025 CTTCTCATGCAGTATGGAAATGG + Intergenic
1007782064 6:44260105-44260127 CATCTCATCCACTCTGTGCAAGG - Exonic
1007848803 6:44783454-44783476 CTTCTCATCCAGACTGTTCAAGG - Intergenic
1008353323 6:50519387-50519409 CTTCTCATTAAGAATGGGAAAGG - Intergenic
1009261231 6:61491642-61491664 CTTTTTGTCCATTATGTGAATGG - Intergenic
1009261485 6:61495531-61495553 CTTTTTGTCCATTATGTGAATGG - Intergenic
1009778157 6:68233050-68233072 CTTCTCCTCCTGTATGTGTGGGG - Intergenic
1010331472 6:74627976-74627998 CTTCTCATGGAGTATCTTAATGG - Intergenic
1011593627 6:88995315-88995337 CTTCTCCTTCAGTGTGTGATGGG - Intergenic
1013727695 6:113119946-113119968 CTTCTCCTCCAAAATGTGTAGGG - Intergenic
1014313491 6:119834100-119834122 CTCCTCATTCAGTATTCGAATGG - Intergenic
1014378306 6:120705656-120705678 ATTCTCATCAATTCTGTGAAGGG - Intergenic
1017599141 6:156061797-156061819 CTGCTCAGCCTGTAAGTGAAGGG + Intergenic
1018204351 6:161423253-161423275 TTTCTCAACTAGTATCTGAAGGG + Intronic
1018226423 6:161633847-161633869 CTGCTCATACAGTATGAGAATGG + Intronic
1018235053 6:161715952-161715974 CTTCTCACCCAGTCTGTCTAGGG - Intronic
1019113361 6:169736802-169736824 CTTCTCATGGAGTATCTTAATGG + Intergenic
1020443052 7:8239596-8239618 CTTCTCACCCAGGAAGTGCAAGG + Intronic
1020501944 7:8934429-8934451 TTTTTCATCCAGTGTGTTAATGG + Intergenic
1020605414 7:10331186-10331208 CTTCACATCCTGTCAGTGAAAGG - Intergenic
1022101355 7:27171180-27171202 CTTCTCTTCCAGTTTCTGTAAGG - Exonic
1022580900 7:31553173-31553195 CTTCTCACCCAGCATGGGGATGG - Exonic
1022823775 7:33988153-33988175 CCTATAATCCAATATGTGAAAGG - Intronic
1023113442 7:36837684-36837706 CTTCTTTTCCAGAATTTGAAGGG + Intergenic
1024832553 7:53478478-53478500 CTTTTCATTCAATATGTGAAGGG + Intergenic
1025594489 7:62907378-62907400 GTTTTTATCCATTATGTGAATGG + Intergenic
1027833594 7:83213320-83213342 CTCCTCATACATTATGTGATGGG - Intergenic
1030701400 7:112645578-112645600 CTTCTCATGGAGTATCTTAATGG + Intergenic
1031800317 7:126235028-126235050 TTTCTCATTCATTAAGTGAAGGG - Intergenic
1031804753 7:126294014-126294036 CTTCTCATGGAGTATCTTAATGG - Intergenic
1032791794 7:135247851-135247873 CTGCTCTTCCAGTATGAGGACGG + Intronic
1034367384 7:150563088-150563110 CCTCTGATCCATTATGTGCAGGG + Intergenic
1034728295 7:153360898-153360920 GTTCTCATCCAGCAAATGAAGGG + Intergenic
1034834404 7:154338269-154338291 CCTCTGATACAGTATCTGAAAGG + Intronic
1035712776 8:1731206-1731228 CTTCTCTTGCAGTGTGGGAAGGG - Intergenic
1036694578 8:10966198-10966220 TTTCTCATTCAGTATGTCGAGGG + Intronic
1037257698 8:16973730-16973752 CTTCTCAACCATTTTGTGAAAGG - Intergenic
1041747430 8:61223667-61223689 CTTCTCATGGAGTATCTTAATGG + Intronic
1043035990 8:75200129-75200151 TTTCTCATTCACTATGTTAATGG + Intergenic
1043800668 8:84605788-84605810 GTTCTCCCCCAGTATGTAAATGG - Intronic
1044377962 8:91498840-91498862 CTTCTCATGGAGTATCTGAGTGG + Intergenic
1046071340 8:109258461-109258483 CATCTCATCTAGTGTGTGAGGGG + Intronic
1046702881 8:117420307-117420329 CTTCTCATGAAGTATGTTACTGG - Intergenic
1046709010 8:117488319-117488341 CTTCTCATGGAGTATCTTAATGG - Intergenic
1048704258 8:137133425-137133447 CTGCTCATCCATTCTGTGGAGGG + Intergenic
1049744104 8:144255890-144255912 CTTCACAGCCAGTGTGAGAAGGG - Intronic
1049877018 8:145030643-145030665 CTTTTGATCCACTATGTGCAGGG - Intergenic
1050982493 9:12037482-12037504 CTTCTCATGGAGTATCTTAATGG - Intergenic
1051094132 9:13445606-13445628 CTTCTCACCCAGTTTCTGATGGG - Intergenic
1051983080 9:23047349-23047371 CTTCTCATGGAGTATCTTAATGG - Intergenic
1052637651 9:31124232-31124254 CATGTGATCTAGTATGTGAAGGG + Intergenic
1054364082 9:64213699-64213721 CTTTTTGTCCATTATGTGAATGG - Intergenic
1055276090 9:74618403-74618425 CTTCTCATGAGGTATGTGAGTGG - Intronic
1056904436 9:90633042-90633064 CTCTCCTTCCAGTATGTGAAAGG - Intronic
1059076479 9:111198541-111198563 CTTCTCATGCAATATGTTATGGG - Intergenic
1060641166 9:125240640-125240662 TTTCTCATCCAGTTAGAGAACGG - Intronic
1062414540 9:136441545-136441567 CTTTCCATCCAGAATCTGAAAGG + Exonic
1185685489 X:1925017-1925039 CTTCTCATCCAGGAGGCCAAGGG - Intergenic
1186088628 X:6019734-6019756 CTTCTCATCCAGTATGTGAAAGG - Intronic
1186259385 X:7760536-7760558 ATTGTCATCAAGTAAGTGAAGGG - Intergenic
1186610147 X:11130977-11130999 CTGCTCATGCAGTCTGTGGAAGG - Intergenic
1187010371 X:15272424-15272446 CTCCTCATCCAGTCTGTGTTGGG - Intergenic
1189558772 X:42171728-42171750 CTTTCCATCCAGTATGCAAAAGG - Intergenic
1190001514 X:46692651-46692673 CTTCTCATCCTGTAGGTTTAGGG + Intronic
1190398385 X:50007501-50007523 CTTCATATCCCTTATGTGAAGGG + Intronic
1190550743 X:51577297-51577319 CTTCTCATGAAGTATCTTAATGG - Intergenic
1191197859 X:57744170-57744192 CTTCTCACCCAGGAAGTGCAAGG + Intergenic
1192018382 X:67357617-67357639 CATCTCATCCAGGAAGTGCAAGG + Intergenic
1192701888 X:73482780-73482802 CTTCTCATGGAGTATCTTAAGGG - Intergenic
1193039456 X:76989005-76989027 CTTCTCATGGAGTATCTTAATGG - Intergenic
1194569803 X:95541948-95541970 CTTCTTATCAGGTATGTGATTGG - Intergenic
1196517104 X:116627238-116627260 CTTCTCATGGAGTATCTTAATGG + Intergenic
1196900900 X:120381769-120381791 CTTGGCAACCACTATGTGAAGGG + Exonic
1200344800 X:155437242-155437264 CTTCTCATGAAGTATCTTAATGG - Intergenic
1200873032 Y:8123885-8123907 CTTTTGATCCATTATGTGCAGGG + Intergenic
1201165255 Y:11203297-11203319 CTTCTCTTCCTTTATGTGTATGG - Intergenic
1202151444 Y:21847548-21847570 CCTTTCATCCATTATGTGCAGGG + Intergenic