ID: 1186091141

View in Genome Browser
Species Human (GRCh38)
Location X:6050110-6050132
Sequence CAGTGCTATCATTTTACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186091141_1186091144 14 Left 1186091141 X:6050110-6050132 CCCACTGTAAAATGATAGCACTG 0: 1
1: 0
2: 1
3: 24
4: 225
Right 1186091144 X:6050147-6050169 GAAGACCCAGTGTTGCCCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 161
1186091141_1186091145 15 Left 1186091141 X:6050110-6050132 CCCACTGTAAAATGATAGCACTG 0: 1
1: 0
2: 1
3: 24
4: 225
Right 1186091145 X:6050148-6050170 AAGACCCAGTGTTGCCCTCAGGG 0: 1
1: 0
2: 2
3: 24
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186091141 Original CRISPR CAGTGCTATCATTTTACAGT GGG (reversed) Intronic
902597765 1:17520824-17520846 CAATGGCATCATTTTACAGCTGG + Intergenic
902918648 1:19653620-19653642 CACTGCACTCATTTTACAGGTGG + Intronic
903384501 1:22917559-22917581 CAATGCTCTCATTTTACAGATGG - Intergenic
903808671 1:26022519-26022541 CTGTGCTGTCATTGTACAGATGG - Exonic
904504961 1:30944707-30944729 CAGTGCTTTCGTTTTAAATTTGG - Intronic
904698271 1:32342728-32342750 CAGTGTCTTCATTTTAGAGTGGG - Intergenic
906709630 1:47919591-47919613 CAATCCTCTCATTTTACAGATGG - Intronic
908176143 1:61556925-61556947 CAGTTCTATCATTTTACTTCTGG - Intergenic
909526734 1:76633022-76633044 CAGTGCTAGCCTTTTTAAGTAGG + Exonic
910013096 1:82489683-82489705 CAGTGCTATAAATATACATTGGG + Intergenic
910955550 1:92699717-92699739 ATGTGCCATCATGTTACAGTTGG - Intronic
911026663 1:93443360-93443382 CAGTTCTATCATAATGCAGTGGG + Intergenic
911496400 1:98637179-98637201 CAGTGCTGTCATGTTAGAGCAGG + Intergenic
912792494 1:112665840-112665862 TAGTGCTATGATTTTAATGTTGG - Intronic
913570712 1:120117360-120117382 CAGTCCTTGCATTTTACAGATGG + Intergenic
914291519 1:146278336-146278358 CAGTCCTTGCATTTTACAGATGG + Intergenic
914467438 1:147944354-147944376 CACTTCTATCATTCTAGAGTAGG + Intronic
914552563 1:148729119-148729141 CAGTCCTTGCATTTTACAGATGG + Intergenic
915345916 1:155196832-155196854 CAATGCCCTCATTTTACAGACGG + Intronic
915758328 1:158285679-158285701 CAATTTTGTCATTTTACAGTGGG + Intergenic
916227535 1:162504336-162504358 CAGTCGTGTCATTTAACAGTAGG + Intronic
916452029 1:164929960-164929982 TAGTGCTCTCATTTTCCACTTGG - Intergenic
917079618 1:171243732-171243754 CAGTGCTTTCATTCTAAAGGTGG + Intergenic
917374264 1:174332191-174332213 CAAGGCTATAATTGTACAGTTGG + Intronic
917374803 1:174339425-174339447 CAGGGCTATAACTGTACAGTTGG + Intronic
919831458 1:201543567-201543589 AAGTGCTAACATTTTACATTAGG + Intergenic
921995432 1:221413060-221413082 CAGTGGTATGTTTTTACAATGGG + Intergenic
923029724 1:230238478-230238500 TAGTACTTTCATTTTACAGATGG + Intronic
923246348 1:232136442-232136464 CAGGGCTATGAGTTTACAATGGG + Intergenic
923248094 1:232153393-232153415 CACTGCTGTCATTTTACTGATGG - Intergenic
924307860 1:242710173-242710195 CAGGGCTATCATTTGTTAGTAGG - Intergenic
924683739 1:246265799-246265821 CAGTGCTTGCTTTTTAAAGTAGG + Intronic
1064622198 10:17228398-17228420 CAGTGCTACCAACTTACAGCTGG - Exonic
1064645736 10:17457179-17457201 CAGTGTTAAAATTTGACAGTAGG + Intergenic
1064774558 10:18761254-18761276 CAGAACTGTTATTTTACAGTGGG + Intergenic
1069442021 10:68437724-68437746 CATTTCTAACATTTTACTGTAGG - Intronic
1069643583 10:69973725-69973747 CAGTGCTAGCATTTCACAGAAGG - Intergenic
1072575027 10:96691454-96691476 CCATGCTATGATTGTACAGTTGG + Intronic
1073958485 10:108898945-108898967 AAATGCTATCATTTTAAAATAGG + Intergenic
1074433754 10:113416193-113416215 CATTGCTCCCATTTTACAGATGG - Intergenic
1074473937 10:113752718-113752740 CTGTCCTCTCATTTTACGGTGGG + Intronic
1074970635 10:118533658-118533680 CAGTCCCCTCATTTTACAGAGGG - Intergenic
1078422522 11:11224161-11224183 CACTGCCTTCAGTTTACAGTGGG - Intergenic
1078830959 11:14976033-14976055 CAGTGCAATCGATTTTCAGTTGG - Intronic
1079017391 11:16880838-16880860 CAGCCTTCTCATTTTACAGTTGG - Intronic
1082930215 11:58595364-58595386 CAATGCTATTATTTTATTGTAGG - Intronic
1085234895 11:75006770-75006792 CAATACTCTCATTTTACAGATGG - Exonic
1085713370 11:78850888-78850910 CAGAGCTAACATGTGACAGTGGG + Intronic
1086037981 11:82439822-82439844 CAGTTCTGTCATTTAACAGTAGG - Intergenic
1087809083 11:102590813-102590835 CAGTTCCATCCTTCTACAGTAGG + Intronic
1090645565 11:128764502-128764524 CAGTGCTATCAGCTGCCAGTGGG + Intronic
1093124675 12:15313894-15313916 CAGTGCTATCCTGTTAGAGCAGG - Intronic
1093196393 12:16134556-16134578 CAGTTTCATCATTTTACAGATGG + Intergenic
1096443962 12:51671691-51671713 CTGTGTTATTATTTTACAGAGGG + Intronic
1097147148 12:56949534-56949556 CAGTGCTATCCTGTTAGAGCAGG - Intergenic
1098615883 12:72521547-72521569 CTCTGCTGTCATTTTACAATAGG + Intronic
1098676717 12:73298774-73298796 CGGTTTTACCATTTTACAGTGGG - Intergenic
1098937900 12:76501596-76501618 CACTGCTGTCATTCCACAGTGGG + Intronic
1100075106 12:90770832-90770854 CAGTTGTATCATAATACAGTGGG + Intergenic
1100131546 12:91500022-91500044 CCGTTATATCATTATACAGTTGG + Intergenic
1100645333 12:96523238-96523260 CAGTCCTTTTATATTACAGTTGG + Intronic
1102128997 12:110510240-110510262 CAGGGCTAACATTTTACAGAGGG - Intronic
1102719998 12:115007804-115007826 CACTGCTCTCATTTTGCAGATGG - Intergenic
1103123577 12:118401094-118401116 TACTGCCTTCATTTTACAGTTGG - Intronic
1108520364 13:51241549-51241571 CAGCCCCCTCATTTTACAGTTGG - Intronic
1108754106 13:53478979-53479001 CAGTACCTTCATTTTACGGTTGG - Intergenic
1108775234 13:53757696-53757718 CAGCGATATCATTTGCCAGTGGG - Intergenic
1109697770 13:65983290-65983312 CAGTATTTTCAATTTACAGTGGG + Intergenic
1109755474 13:66753299-66753321 AACTGCAGTCATTTTACAGTGGG - Intronic
1110286081 13:73751840-73751862 AAGTGGCATCATTTTACAATGGG + Intronic
1110319443 13:74143931-74143953 CAGTATTTTCAATTTACAGTTGG + Intergenic
1111547020 13:89751874-89751896 CTGTGCTCTCATTTTTCACTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113420379 13:110166676-110166698 TAGTTGGATCATTTTACAGTTGG - Intronic
1117051226 14:51861373-51861395 CACAGCTATCATTTGCCAGTAGG + Intronic
1118745809 14:68772305-68772327 CAATGGTCTCATTTTACAGATGG - Intergenic
1118986808 14:70763096-70763118 CAGTGGTAGAAGTTTACAGTGGG - Intronic
1119338546 14:73855163-73855185 CAAAGATATCTTTTTACAGTTGG - Intronic
1119931855 14:78555086-78555108 TAGTGATCTCATTTTACAGAGGG - Intronic
1121825933 14:97009463-97009485 CAGTCTCATCATTTTACAGATGG + Intergenic
1122175622 14:99916365-99916387 CAATGCTTTCTTTCTACAGTGGG - Intronic
1123837762 15:24213148-24213170 CAGTGCTGTAAATTTACAGTAGG + Intergenic
1123847298 15:24315462-24315484 CAGTGCTGTAAATTTACAGTAGG + Intergenic
1123866293 15:24522529-24522551 CAGTGCTTTAAATTTACAGTAGG + Intergenic
1124463540 15:29915463-29915485 CAGAGCAATGATTTTCCAGTTGG - Intronic
1126208909 15:46077589-46077611 AAGTGCTGTCATTTTACACTGGG - Intergenic
1126976656 15:54189888-54189910 CACTTCTATTTTTTTACAGTAGG - Intronic
1127439268 15:58990001-58990023 AACTGCTATCATTTTTCAGATGG - Intronic
1127832750 15:62765159-62765181 CAGTGCTGTCTTATTACAGATGG - Intronic
1128307001 15:66605290-66605312 CAATCCTCTCATTTTATAGTTGG - Intronic
1129043918 15:72716119-72716141 CAGTGTTTTCAATTTACAATGGG + Intronic
1129703553 15:77781888-77781910 CAGGGCTACCATTTTGCAGATGG - Intronic
1130102784 15:80906524-80906546 CAGTGGTCTCATGTTACAGAAGG - Intronic
1131343252 15:91622620-91622642 CATTGCTATCATTTTTTAGTTGG + Intergenic
1133484338 16:6204236-6204258 AACTGCTTCCATTTTACAGTGGG + Intronic
1133555759 16:6905127-6905149 CAGCATTAGCATTTTACAGTTGG + Intronic
1136158178 16:28399741-28399763 AACTGTTAGCATTTTACAGTAGG - Intronic
1136204909 16:28715542-28715564 AACTGTTAGCATTTTACAGTAGG + Intronic
1137627456 16:49918527-49918549 TAGTGCCCTCATTTTACAGGTGG + Intergenic
1138426778 16:56939652-56939674 CTGTGCCATAATCTTACAGTGGG + Intronic
1142051750 16:87963331-87963353 CTGTGCTAACTTTTTACAGCAGG + Intronic
1143921747 17:10335933-10335955 AAGGACCATCATTTTACAGTGGG + Intronic
1144380894 17:14696900-14696922 CACTCGAATCATTTTACAGTAGG + Intergenic
1146260144 17:31415630-31415652 CAGTGCTGTCATTGTCCAGATGG + Intronic
1146463492 17:33066599-33066621 CAGTGCCTTCACTTTACAGATGG + Intronic
1146555019 17:33815804-33815826 CAATCCTCTCATTTTACAGATGG + Intronic
1148085511 17:44991425-44991447 CAGCTCTCTCATTTTACAGATGG - Intergenic
1148746395 17:49920607-49920629 CAATGCTATCATTTTACAGATGG - Intergenic
1150839337 17:68593584-68593606 AAGTGGGATGATTTTACAGTTGG + Intronic
1153650790 18:7238042-7238064 CAGAGCTTTCATTTTCCAGTGGG - Intergenic
1155234212 18:23803407-23803429 CACTTCTATCATTGTCCAGTGGG - Intronic
1155405381 18:25481744-25481766 CACTGCAATAATTTTATAGTTGG + Intergenic
1156788765 18:40947333-40947355 CAGTGTTCTCATTTTACTGCAGG - Intergenic
1156832776 18:41514786-41514808 TAGTGCTGTCTTCTTACAGTGGG + Intergenic
1157037549 18:43993686-43993708 CACGTCTTTCATTTTACAGTTGG + Intergenic
1164182203 19:22829245-22829267 CAGTTCTGCTATTTTACAGTAGG + Intergenic
1166050887 19:40258406-40258428 AAGTGCTAGGATTTTACAGGTGG - Intronic
925259394 2:2516833-2516855 AAGTGCTATTATTCTCCAGTGGG - Intergenic
925587344 2:5476568-5476590 TAATGCCATTATTTTACAGTAGG + Intergenic
930360924 2:50378423-50378445 CAGTGATATGAGCTTACAGTTGG + Intronic
930463974 2:51721242-51721264 CAATGTTATCATTTTACACTAGG - Intergenic
930598392 2:53415171-53415193 CATAGCTATCATTTTGTAGTGGG + Intergenic
931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG + Intergenic
932084101 2:68742487-68742509 GATTGCACTCATTTTACAGTTGG - Intronic
935198814 2:100837914-100837936 CAGCACCATCATTTTACAGAAGG + Intronic
937515900 2:122655232-122655254 AAGTTCTATCATTTGGCAGTTGG + Intergenic
938779051 2:134568148-134568170 CAGATCTATCATGTTCCAGTAGG + Intronic
939385052 2:141485447-141485469 CAGTGCTAGGATATTTCAGTTGG + Intronic
939565966 2:143786810-143786832 AAGTGCTATCATTCTGCAGTTGG - Intergenic
940840720 2:158578047-158578069 CAATGAAAGCATTTTACAGTAGG - Intronic
941567048 2:167122325-167122347 CTGTGCTCTCATTTTACAGCTGG - Intronic
941867226 2:170347654-170347676 CAGAGCTATCATTTAACACCAGG + Intronic
941889378 2:170562698-170562720 AACTGCAATCATTTTACAGGAGG - Intronic
942921411 2:181378047-181378069 TAGTTATGTCATTTTACAGTAGG + Intergenic
943397647 2:187360233-187360255 CAATGCTCTCATTTTACACGTGG + Intronic
943924916 2:193763030-193763052 CAGTGCTACCCTATTGCAGTAGG + Intergenic
944454951 2:199883763-199883785 CAGGGCTATCAATTGAGAGTAGG - Intergenic
945586124 2:211665437-211665459 AAGTGCTCTCATTTTAAAGATGG - Exonic
945932526 2:215869719-215869741 CAGTCCTAACATTTTACACCTGG + Intergenic
947139251 2:227006230-227006252 CAGAGCTATCATTATGCACTTGG - Exonic
1172347899 20:34218605-34218627 CAGTGCTGTCATTTAACAGGGGG + Intronic
1173168746 20:40705337-40705359 CAGTCCTATCACTGTGCAGTTGG + Intergenic
1173170518 20:40719838-40719860 TAGTACCATCATTTTACAGATGG + Intergenic
1173439768 20:43065853-43065875 CAGACCTCTCATTTTACAGTTGG + Intronic
1173869767 20:46334078-46334100 AAGCCCTCTCATTTTACAGTTGG - Intergenic
1174279922 20:49431956-49431978 CAGTCCTATCATTGTACAGATGG + Intronic
1174282279 20:49447913-49447935 CCGAGCTATCATTTTACACAAGG - Intronic
1175656273 20:60773890-60773912 CAGTGCATTCATTTCACTGTTGG - Intergenic
1177326767 21:19600902-19600924 CCGTTCTATTATTTTGCAGTGGG - Intergenic
1177562548 21:22774928-22774950 TAATGCTATCATTTTATATTAGG - Intergenic
1179106440 21:38404702-38404724 CAGTGCTCTTAGTTTACAGGTGG - Intronic
1179682393 21:43032621-43032643 CAGTGCTCTCTTTTTATAGATGG - Exonic
1182680467 22:32075427-32075449 CTGCGCTTTCATTTTACAGATGG + Intronic
1182682090 22:32087825-32087847 AAATTCTTTCATTTTACAGTTGG + Intronic
950542462 3:13620562-13620584 CAATGGCCTCATTTTACAGTGGG - Intronic
952021946 3:29033585-29033607 AATGACTATCATTTTACAGTAGG - Intergenic
952523175 3:34182992-34183014 AAGTAATATCATTTGACAGTCGG - Intergenic
953668805 3:44945338-44945360 CAGCTCTAACATTCTACAGTGGG + Intronic
956333739 3:68140629-68140651 CATTGCCTTCATTTTACAGATGG - Intronic
956826378 3:73000966-73000988 CAGTGGTAGCCTTTTCCAGTTGG + Intronic
957501227 3:81059195-81059217 CTGTGGTATCTTTTTACATTGGG - Intergenic
960111037 3:113845157-113845179 CAGTAGTCTCATTTTCCAGTGGG - Intronic
960340215 3:116465930-116465952 CAGCTCTTTCATTTTACAATTGG + Intronic
962062898 3:131949853-131949875 CAGTGCTAGCATTTTAATGGAGG - Intronic
962143492 3:132815753-132815775 TAGTGATATTATTTTTCAGTTGG + Intergenic
963722344 3:148876970-148876992 CAGTATTATCACTTTACAGATGG - Intronic
964615665 3:158661776-158661798 CAGTGCTATTCTGTTAGAGTTGG - Intronic
967316365 3:188154611-188154633 AAGTCCTCCCATTTTACAGTTGG + Intronic
967824959 3:193870316-193870338 CAGTGCTCTCGTTTCACAGATGG + Intergenic
968840119 4:2997507-2997529 AAGTGCTATCATTTGAACGTTGG - Intronic
969090693 4:4691939-4691961 CAGTGATATCATTTAACAAAGGG - Intergenic
972300392 4:37780160-37780182 CAGTGATATCATTTTTCATCAGG + Intergenic
972367155 4:38386843-38386865 CACTGCCCTCATTTTACAGATGG - Intergenic
972670501 4:41210308-41210330 CAGCTCTCTCATTTTACAGATGG + Intronic
973572499 4:52254818-52254840 CAGTGTTAAGATTTTATAGTAGG + Intergenic
974017141 4:56657627-56657649 CAGTGCTATGATTTTTAGGTGGG - Intronic
974131390 4:57760702-57760724 CAGGCCTCTCATTTTTCAGTTGG - Intergenic
975940244 4:79635152-79635174 CAGAGTTATCATTTTACTTTGGG - Intergenic
979880413 4:125950220-125950242 CATTGCTATCATTTTCTAATTGG - Intergenic
981791855 4:148546548-148546570 AAGTGTAATCATATTACAGTTGG + Intergenic
984835827 4:184019907-184019929 CAAAGCTATGATTTTACAGGAGG - Exonic
986606417 5:9527736-9527758 TATTGCTATCATTTTAGAATTGG + Intronic
989814646 5:45721513-45721535 CAGTGCTACCATTTTACTCTGGG + Intergenic
990524461 5:56610995-56611017 CAGTGCTACAAATGTACAGTGGG + Intergenic
990946515 5:61255036-61255058 CAGTGCCATAATTTCACAGCTGG + Intergenic
992681153 5:79154575-79154597 CAGAGCTATCTCTTTACAATGGG + Intronic
992776851 5:80096552-80096574 CAGCCTTTTCATTTTACAGTTGG + Intergenic
994554418 5:101279910-101279932 CAGTGCTATCCTTTTTGAGGAGG + Intergenic
995803788 5:116028765-116028787 CAGGGAAATCATTTTATAGTTGG - Intronic
996205195 5:120725723-120725745 CAAGGCTATCACATTACAGTAGG - Intergenic
997705353 5:135945771-135945793 CAGTGCTGTAGTTTTGCAGTTGG - Intronic
998199154 5:140105592-140105614 AATTGCTACCATTTTACATTTGG + Intergenic
998586307 5:143431219-143431241 CAGTGCATTCATTTTTCAATAGG + Intronic
999505955 5:152196529-152196551 CAATTCTATCATTTTACAGACGG - Intergenic
999675906 5:154002529-154002551 TAGTGATATAATTTTACAGCTGG + Intronic
999713850 5:154343294-154343316 CAGTCCCCTCATTTTTCAGTAGG + Intronic
1000254630 5:159526106-159526128 GAGTGCAATCATTTTACAAATGG + Intergenic
1000911992 5:167033716-167033738 CAGTGGGATCATTTGAAAGTAGG + Intergenic
1001145281 5:169178357-169178379 CAATGCCCTCATTTTACAATTGG - Intronic
1001175930 5:169468925-169468947 CATTGCTAACATTTTATAATTGG + Intergenic
1002993468 6:2259670-2259692 CAGTGTTATCATCTTGCTGTGGG - Intergenic
1004226231 6:13786627-13786649 CAGTGTTATCATTATACAATTGG + Exonic
1004232008 6:13842158-13842180 CACTCCTATCAGTTAACAGTGGG - Intergenic
1006471370 6:34231069-34231091 CAGTTCAATCATGTTCCAGTGGG - Intergenic
1006909228 6:37553150-37553172 CACTGCTCTCCTGTTACAGTGGG - Intergenic
1009346809 6:62623199-62623221 CAGTGCTATATTTTTATTGTAGG + Intergenic
1009723095 6:67501362-67501384 AATTGCAATCATTTCACAGTTGG + Intergenic
1010146873 6:72680511-72680533 GAGTGTTATCATTCTCCAGTTGG - Intronic
1011991904 6:93531602-93531624 CAGTGCTTTCAGTTTACAGAGGG + Intergenic
1014596096 6:123341450-123341472 CATTGCTATCTTTTTAAACTTGG + Intronic
1014997569 6:128169165-128169187 CAGTGCTTTCAGTTTACAATAGG - Intronic
1015643114 6:135358709-135358731 CTGTGTTATCATTTTAAAGGAGG - Intronic
1016142412 6:140628698-140628720 TAGTGAAATCATTTTACATTAGG - Intergenic
1017239373 6:152149968-152149990 CAGTGCTGTCAACTTACGGTGGG - Intronic
1019813023 7:3178815-3178837 AAGTTCTTGCATTTTACAGTTGG + Intergenic
1021075326 7:16297203-16297225 CATTGCTCTCATTTTGCAGTTGG - Intronic
1021281299 7:18721921-18721943 CATTGCCATCATTTGAAAGTGGG - Intronic
1023524006 7:41079830-41079852 CAGAGCTCTCATTTCCCAGTGGG - Intergenic
1027789904 7:82626664-82626686 CAGTGCTACCTTTTTATTGTAGG + Intergenic
1028641405 7:93045745-93045767 CAGTGCTCCCATTCTAGAGTGGG + Intergenic
1029055823 7:97741479-97741501 CATTATTATCATTTTACAGATGG + Intergenic
1029461599 7:100697236-100697258 CAGTGTTCACACTTTACAGTTGG + Intergenic
1031146825 7:118005989-118006011 CAGTGCTATAATTGTACTGATGG + Intergenic
1032311861 7:130794856-130794878 CAGTGCTAGCAGTTTACACTTGG + Intergenic
1038566568 8:28623946-28623968 CATTGCTAGCATTTTAGACTTGG - Intronic
1038896524 8:31789466-31789488 CAGTTATATAATTTTACATTTGG - Intronic
1039259518 8:35755671-35755693 CTGTTTCATCATTTTACAGTGGG - Intronic
1041605960 8:59782694-59782716 AAGAGCTATCCTTTTTCAGTAGG + Intergenic
1041804932 8:61839584-61839606 GAAGGCTTTCATTTTACAGTGGG + Intergenic
1044855984 8:96476410-96476432 CAATGCTTAAATTTTACAGTTGG + Intergenic
1044953179 8:97453139-97453161 CAATACTGTCATTTTACAGGAGG - Intergenic
1045758817 8:105578576-105578598 AAATTCTATCATTTTACAATTGG - Intronic
1048202307 8:132384832-132384854 CAGTGTTTCCATTTTACAGATGG - Intronic
1050145101 9:2559408-2559430 CAGTGCTGCCCTGTTACAGTGGG + Intergenic
1050394590 9:5181743-5181765 AATTGTTATCATTTTCCAGTTGG - Intronic
1051066233 9:13106900-13106922 CAGTGCATTCTCTTTACAGTAGG + Exonic
1051167426 9:14279157-14279179 CAATGCCATCATTATACAGACGG + Intronic
1055707375 9:79020450-79020472 CAGAGCAATCATTTTAGACTAGG - Intergenic
1060027580 9:120185983-120186005 TATTGCTCTCATTTTACAATGGG + Intergenic
1060072820 9:120565206-120565228 CAGTGCTTTCATTTGACATGTGG - Intronic
1061250332 9:129422718-129422740 CATTGCTCCCATTTTGCAGTTGG - Intergenic
1186091141 X:6050110-6050132 CAGTGCTATCATTTTACAGTGGG - Intronic
1186840387 X:13479115-13479137 GAGTCCTAGTATTTTACAGTTGG + Intergenic
1186869777 X:13759552-13759574 CACTGCTCCCATTTTACAGATGG - Intronic
1186894118 X:13988919-13988941 CAGTTCTACCATTTTTCTGTTGG - Intergenic
1187635804 X:21226912-21226934 CAGTGCCATCTGTTTACAGCAGG + Intergenic
1188078916 X:25812498-25812520 TAGAGCTAGCATTTGACAGTAGG + Intergenic
1188090438 X:25957890-25957912 CAACGATATCTTTTTACAGTTGG + Intergenic
1191697046 X:64000849-64000871 CAATTCTTTCATTTTACAGATGG + Intergenic
1197834377 X:130679002-130679024 CAGTTCTAGCATGGTACAGTAGG + Intronic
1202201285 Y:22352716-22352738 CACTATTATCATTTTACATTTGG - Intronic