ID: 1186100649

View in Genome Browser
Species Human (GRCh38)
Location X:6152613-6152635
Sequence CTTTGGACACAAATTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186100647_1186100649 14 Left 1186100647 X:6152576-6152598 CCACAAAGGGAACATCATCAAAT 0: 1
1: 0
2: 3
3: 33
4: 677
Right 1186100649 X:6152613-6152635 CTTTGGACACAAATTCTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186100649 Original CRISPR CTTTGGACACAAATTCTCCT TGG Intronic
900605701 1:3522690-3522712 CTTGGGACACTCACTCTCCTAGG - Intronic
901940991 1:12661575-12661597 TTTGGGACTCAAATTCACCTTGG - Intronic
901990912 1:13113165-13113187 CTATGGCCATAAATTATCCTGGG - Intergenic
903849182 1:26296070-26296092 CTTTGGAAACCAATTCTGCGTGG + Intronic
904357545 1:29950461-29950483 ATTTGGACACAGATACTACTTGG + Intergenic
904750944 1:32741437-32741459 CTTGGGATACCAAGTCTCCTGGG + Intergenic
906435623 1:45794018-45794040 CTTAGGGCACCAAATCTCCTAGG + Intronic
906779562 1:48560468-48560490 GGTTGGACACAAATGCCCCTGGG + Intronic
907324313 1:53626976-53626998 CTGTGAACACACATTCTCCAGGG + Intronic
908641154 1:66225040-66225062 CTCTGGACACCACTTCACCTTGG + Intronic
909771034 1:79421645-79421667 CTTTGAACTCTAATTCTTCTAGG + Intergenic
912437156 1:109669628-109669650 TTTTGGACACAAACTCTGCAGGG - Intronic
914832780 1:151182743-151182765 TTTTTAACACAAACTCTCCTGGG + Intronic
917394732 1:174580872-174580894 CTTTGGAGAAATATTCTCTTTGG - Intronic
917823541 1:178791965-178791987 CTTTGTACAAAGATTGTCCTTGG + Intronic
918276996 1:182962593-182962615 CTTTGGAAACAAATACTCAATGG + Intergenic
919030522 1:192236376-192236398 TTAGTGACACAAATTCTCCTTGG + Intergenic
921443158 1:215213306-215213328 CTTTATAAAAAAATTCTCCTGGG + Intronic
921452928 1:215330992-215331014 ATTTTGACACAAAATCTCCAGGG - Intergenic
921771482 1:219045905-219045927 CTTTGGTCACACTTTCACCTAGG + Intergenic
923730279 1:236543489-236543511 CTTTGGACACGAGTTTTCCCTGG + Intronic
924819510 1:247474961-247474983 TTTTGAACAAAAATTCCCCTGGG - Intergenic
924879507 1:248144827-248144849 CTTTGGAGACATATTCTTTTTGG + Intergenic
924882661 1:248179669-248179691 CTTTGGAGACATATTCTTTTTGG + Intergenic
924892657 1:248300156-248300178 CTTTGGAGACATATTCTTTTTGG - Intergenic
924894814 1:248324866-248324888 CTTTGGAGACATATTCTTTTTGG - Intergenic
1065648544 10:27863526-27863548 CATTATTCACAAATTCTCCTTGG - Intronic
1066546705 10:36507926-36507948 ATTTGGACAGAAATTGCCCTTGG - Intergenic
1069179233 10:65335406-65335428 ATTTGGTCACAAATTCTACCAGG + Intergenic
1069273973 10:66566758-66566780 CTTGGGAAAGAAATTCACCTTGG - Intronic
1071257589 10:83886132-83886154 CCATGGTCACAAATTATCCTAGG + Intergenic
1071802547 10:89079782-89079804 ATTTGGAGAAAAATTCTCTTTGG - Intergenic
1073922406 10:108474070-108474092 CTTTGGAATCAAAACCTCCTTGG + Intergenic
1075272458 10:121064231-121064253 CTCTGGACAAAAGTTTTCCTAGG - Intergenic
1077932153 11:6744769-6744791 CTTTGGCCACATCTTCTTCTAGG + Intergenic
1078313157 11:10266748-10266770 CTTTGGCCAAAACTTATCCTGGG - Intronic
1080255096 11:30281878-30281900 CTTATCACACAAACTCTCCTAGG - Intergenic
1082918469 11:58465407-58465429 CTTAGGGGACAATTTCTCCTGGG + Intergenic
1083207668 11:61162152-61162174 ATTTGGTCTCAAATTCCCCTGGG - Intergenic
1083722781 11:64611664-64611686 CTTGGGACACACAGGCTCCTCGG + Intronic
1086960735 11:92978091-92978113 GGTTAGACATAAATTCTCCTTGG - Intronic
1088435536 11:109808469-109808491 CTTTGGATACAAGTTCTATTTGG - Intergenic
1088670469 11:112135287-112135309 CTTTGGACACAATCTCTCTGAGG - Intronic
1089925190 11:122249559-122249581 CATTGGAGAGTAATTCTCCTAGG - Intergenic
1091072857 11:132585219-132585241 ATTTGGTCTCAAATTCTACTGGG + Intronic
1092673441 12:10889194-10889216 TGTTGGAAAGAAATTCTCCTAGG + Intronic
1095195496 12:39310575-39310597 GTTTGGAAACTAATTCTACTTGG - Intronic
1095532575 12:43206941-43206963 CTTTTGAAAGAAATTCTACTGGG + Intergenic
1096820680 12:54231652-54231674 CTTTGGACACTATTTCTACTTGG - Exonic
1097402639 12:59148161-59148183 CTTTGCTCACCACTTCTCCTTGG + Intergenic
1098499429 12:71173377-71173399 CTTTGGAAGAAAATTCTCCATGG - Intronic
1099464406 12:82965418-82965440 CTTATGACACAAATACTCATGGG - Intronic
1099848160 12:88056416-88056438 CTTTGGCAACAAAATCTGCTAGG + Intronic
1100299853 12:93296965-93296987 CTGTGGACTCAGATTCTTCTTGG + Intergenic
1100730852 12:97466440-97466462 ATTTGGAGACAAGTACTCCTCGG + Intergenic
1103191636 12:119006671-119006693 CCAAGGACACAAATTCTCCTTGG - Intronic
1104235549 12:126932197-126932219 CTTTGGACACAAATGCTCTCAGG - Intergenic
1106544770 13:30720933-30720955 CTGTGGGCACAAATGCTCTTTGG + Intronic
1108106341 13:47014567-47014589 CTTTGGACACTGGTTCTACTTGG + Intergenic
1108339141 13:49479362-49479384 CTTTGCACACAAAATCACATGGG + Intronic
1108474527 13:50800710-50800732 CTTTGGACAAATACTCTGCTTGG + Intronic
1108577883 13:51804672-51804694 CTTTGGAGACAATTACTTCTCGG - Intergenic
1109255140 13:60071211-60071233 CTTTGGGGTCAACTTCTCCTTGG - Intronic
1110490727 13:76102565-76102587 GTTTGCACACATATACTCCTTGG + Intergenic
1114168661 14:20248571-20248593 TTTTTGAGACAAGTTCTCCTTGG - Intergenic
1116772141 14:49138869-49138891 TTTTGGCCACAGATTTTCCTAGG - Intergenic
1116811856 14:49547005-49547027 CCTGGAACACAAATTCTCTTTGG - Intergenic
1117099692 14:52333667-52333689 CTTGGGACTCACATTCTACTCGG - Intergenic
1119233224 14:72997695-72997717 CTTTGGACAGAAATCTTTCTGGG + Intronic
1121909560 14:97776651-97776673 CCTTGGCCATAAATTCTCATTGG + Intergenic
1126274304 15:46858285-46858307 CTATGGCCAGCAATTCTCCTGGG + Intergenic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1133150859 16:3828536-3828558 CATTTGACAAAAATACTCCTGGG + Intronic
1133688389 16:8189107-8189129 GTTTGCACATAAATTCTCCCCGG - Intergenic
1135797352 16:25458152-25458174 CTTTGGACAATAATTGTCCTTGG + Intergenic
1140947146 16:79779561-79779583 CTAGGGACAAAATTTCTCCTTGG + Intergenic
1140979580 16:80093973-80093995 CTTGGGATACAAATACTCCCAGG - Intergenic
1143830455 17:9646314-9646336 CTTTGTAAATTAATTCTCCTAGG + Intronic
1149194392 17:54102352-54102374 CATAGGACACAAAATCTCCTGGG - Intergenic
1157131779 18:45014082-45014104 ATTGGGACTCAAATTCTCCAAGG + Intronic
1158313788 18:56188472-56188494 CTGGGGCCACAGATTCTCCTGGG - Intergenic
1158594656 18:58805680-58805702 GTTTGGACACAAAGCCTCTTAGG + Intergenic
1164450008 19:28352368-28352390 CTTTGGAGACAAAGACTCCATGG + Intergenic
1168416230 19:56170594-56170616 CTCTGCACAGAAATGCTCCTGGG + Intergenic
1168533125 19:57145895-57145917 CTTTGGATACCTCTTCTCCTGGG - Intergenic
1168587558 19:57605864-57605886 CTGTGGACAGAAATTGTACTTGG + Exonic
925973791 2:9126564-9126586 CTTTGAACACAAAATCTACTAGG + Intergenic
926143205 2:10380806-10380828 CATTGGCCGCAAAATCTCCTGGG + Intronic
927530947 2:23799969-23799991 CTTTGGAAAAAAATAATCCTTGG - Intronic
928520236 2:32081441-32081463 CTTTTGCCACAGCTTCTCCTGGG + Intronic
929996166 2:46827607-46827629 CCTAGGACACAAGTTCTGCTGGG - Intronic
930337253 2:50064717-50064739 CTTTGGAAGTAAATGCTCCTTGG - Intronic
931750860 2:65328667-65328689 CTTTGGACTCAAAACCTTCTTGG - Intronic
936973724 2:118198840-118198862 CTTTGGACACAGATTCACACAGG - Intergenic
937504523 2:122522168-122522190 GTTGGGAGACAAATTCTCATTGG + Intergenic
939348775 2:141004225-141004247 GTTTGGTCACACATTATCCTAGG + Intronic
939429373 2:142083190-142083212 CTTTAGACACATAAACTCCTTGG - Intronic
939725734 2:145719271-145719293 CTATGGACACAGGTTCTACTTGG + Intergenic
940995594 2:160145984-160146006 CTTTGGACAGTAACTCTACTGGG + Intronic
941134325 2:161695456-161695478 TTTTAGAGATAAATTCTCCTTGG + Intronic
941313218 2:163960341-163960363 CTTTGGAATCAAACTGTCCTGGG + Intergenic
943401299 2:187414710-187414732 CATTGAAGACAAATTTTCCTAGG + Intronic
943423547 2:187699424-187699446 CTTTGAACACACATGCTCCATGG - Intergenic
944557142 2:200898575-200898597 CTTTGGACACTAACTCCCTTGGG - Intronic
944804244 2:203265308-203265330 CTTTGGAGACAAAATCACCCTGG + Intronic
1168737516 20:155039-155061 CTGTAGCCACAAATTCTCATGGG - Intergenic
1172689999 20:36783665-36783687 CTTGGGACCCCAATTCTCCAGGG + Exonic
1173004388 20:39128512-39128534 CTTTGGACAGAAATTATCCATGG + Intergenic
1175767965 20:61604154-61604176 CTTTGGACACAAAAGCTAATCGG - Intronic
1177449386 21:21245588-21245610 CTTTGGACCCAAATTGCCCGAGG + Intronic
1179510180 21:41867351-41867373 CTTTGCACAAAACTTTTCCTGGG - Exonic
1179596475 21:42446115-42446137 CTTTGGCCACAAAGGCTCATGGG - Intronic
1179943350 21:44654083-44654105 CTTTCTACACAGTTTCTCCTGGG - Intronic
1180631977 22:17236029-17236051 CTTTGAACACACTTTCTCCCTGG - Intergenic
1183488293 22:38102132-38102154 CTTTGGACTCACAAACTCCTTGG - Intronic
1203237039 22_KI270732v1_random:14146-14168 CGTTTGTCACAAATTCTCATTGG + Intergenic
949524703 3:4891689-4891711 CTTAGGACACAAATGTTTCTAGG - Intergenic
950865335 3:16184092-16184114 CTTTGGACTCAAATCAACCTGGG - Intronic
952655622 3:35781840-35781862 GTTTAGTCCCAAATTCTCCTTGG + Intronic
954856888 3:53651879-53651901 CATTGGAGACTAATTCTGCTGGG + Intronic
955948617 3:64219794-64219816 ATTTGGACTCTAATTATCCTGGG + Intronic
957402241 3:79731389-79731411 GTATGGACTCAAATTCTCCAAGG + Intronic
958613179 3:96453590-96453612 CTTTTGACACATATTCTCTCAGG - Intergenic
959724734 3:109530648-109530670 CATTGTACACAAATGATCCTTGG - Intergenic
961575481 3:127832489-127832511 TTTTGGCCACATATTCTTCTTGG - Intergenic
963223421 3:142836168-142836190 TTTTGGTCAGAAATTCTCATCGG + Intronic
963462501 3:145634576-145634598 ATTTGGACACAAATTCGCATAGG + Intergenic
963869426 3:150399059-150399081 GTTTGTACTCAAAATCTCCTTGG - Intergenic
964444723 3:156746782-156746804 CTTGGGAAACAAAATCTCTTAGG - Intergenic
967483736 3:190005763-190005785 CTTTGGAATAAAATTCCCCTTGG - Intronic
969395847 4:6920704-6920726 CTTTGGACTCACACGCTCCTGGG - Intronic
969901744 4:10356330-10356352 CTTTGCACACACATTTTCCTGGG - Intergenic
975060742 4:69995188-69995210 ATTTTTACACAAATTTTCCTAGG + Intergenic
975956473 4:79846645-79846667 ATTTGGACAAACATTTTCCTAGG - Intergenic
978037542 4:104014241-104014263 CCTGAGAGACAAATTCTCCTGGG + Intergenic
979606599 4:122645071-122645093 CTTTGGGAACAAACACTCCTAGG + Intergenic
982562689 4:156949565-156949587 CTTTGCACAGACATTCTTCTGGG - Intronic
983939737 4:173526835-173526857 CTTTGGATATAAATATTCCTGGG - Exonic
984472113 4:180189474-180189496 TATTGGACACAAATATTCCTAGG + Intergenic
984864323 4:184268382-184268404 CTTTGGATTCTAATTTTCCTTGG - Intergenic
985879580 5:2628247-2628269 CTTAGGACAAATATTTTCCTGGG - Intergenic
986191605 5:5501290-5501312 CTTTGGGTAGAAATTCTTCTGGG - Intergenic
986462612 5:7988339-7988361 CTTTGGTTACAAATTCTACCAGG + Intergenic
987296202 5:16554183-16554205 CTTTTGACACAAAGTCTCACAGG - Intronic
987995088 5:25266718-25266740 CTTATGACAAAAATTTTCCTAGG - Intergenic
988556401 5:32239817-32239839 CCTAGGAGACAAACTCTCCTTGG + Intronic
989351123 5:40487934-40487956 CTTTGGGCACCAATTCTGCCTGG + Intergenic
990588894 5:57241907-57241929 TTTTCTCCACAAATTCTCCTAGG - Intronic
992968434 5:82028685-82028707 CTTTTGACAAAACTTTTCCTCGG - Intronic
993295414 5:86132720-86132742 CTGTGGATACCAATTCTTCTTGG - Intergenic
993685575 5:90933548-90933570 ATTTGGAGAAAAATTCTACTAGG - Intronic
994693205 5:103043480-103043502 ATTTGGTCTCAAATTCTACTAGG + Intergenic
995764396 5:115600413-115600435 CTTGGGATACAAATTGTCCTGGG + Intronic
998530977 5:142884239-142884261 CTTTGGAGGCACATTGTCCTAGG + Intronic
1002840447 6:900632-900654 CGTTGGATAAAAATGCTCCTTGG - Intergenic
1004426812 6:15512288-15512310 CTTTGGACACAAAGGATCCCGGG - Exonic
1006888412 6:37401628-37401650 CTTTGGACATTAAGTCTGCTGGG - Intergenic
1007079124 6:39086266-39086288 CCATGGACACATTTTCTCCTAGG + Exonic
1011849628 6:91610261-91610283 CATTTGGCACAAATTCTACTTGG + Intergenic
1012719016 6:102717468-102717490 CTTTGGACACAAAAGGGCCTTGG + Intergenic
1013051623 6:106541240-106541262 CTCTGGACCCAGATTCTCCCAGG - Intronic
1015370356 6:132443998-132444020 CTTTGGAGAAAGATGCTCCTGGG - Intergenic
1015525065 6:134168134-134168156 CTTTGGACTCAAGATCTCCAAGG + Intergenic
1017181161 6:151553677-151553699 CTTTGGAAACACATTCACTTTGG + Intronic
1019015637 6:168877909-168877931 CTGTGGGGACACATTCTCCTTGG - Intergenic
1022318614 7:29266965-29266987 CTTCAGACACAAAGTGTCCTTGG - Intronic
1024809881 7:53196766-53196788 CCCTGGACATAAATTGTCCTTGG + Intergenic
1024934588 7:54699493-54699515 ATTTGGACAAAACTTATCCTGGG - Intergenic
1025742270 7:64207346-64207368 CTGAGGACCCAAATCCTCCTTGG + Intronic
1025746725 7:64249261-64249283 CTGAGGACCCAAATCCTCCTTGG + Intronic
1026950204 7:74341780-74341802 CTCTGGACAGAACTTCCCCTGGG + Intronic
1027491862 7:78837513-78837535 ATTTGGAGACAAGTTCTCCATGG + Intronic
1027511117 7:79081308-79081330 CCTTTGTCACAAATTCTCCTAGG + Intronic
1029310646 7:99660408-99660430 CTTTTTATAAAAATTCTCCTGGG + Intronic
1029315625 7:99710641-99710663 CTTTTTATAAAAATTCTCCTGGG + Intronic
1029321378 7:99763764-99763786 CTTTTTATAAAAATTCTCCTGGG + Intronic
1031579341 7:123451919-123451941 CTTTGTAAATAAACTCTCCTTGG + Intergenic
1031683607 7:124705286-124705308 CCTTGGCTAAAAATTCTCCTTGG + Intergenic
1031712175 7:125062356-125062378 AATTGGACACGAATTCTCCTAGG + Intergenic
1032551785 7:132791132-132791154 CTTTGGGTACAGAGTCTCCTGGG + Intronic
1033071995 7:138211489-138211511 CATTACACACAAATTCTCCCAGG + Intergenic
1034108238 7:148510366-148510388 CATTGGACACATATTTTTCTAGG + Intergenic
1035747005 8:1968330-1968352 CTCTGGACAGCAGTTCTCCTTGG + Intergenic
1039155561 8:34552787-34552809 CTTTGGACACAAATACGACCAGG - Intergenic
1043615680 8:82122368-82122390 CTTTGAGCCCAAATCCTCCTTGG + Intergenic
1046790779 8:118319515-118319537 CTTGGGCCACAACTTCTGCTAGG - Intronic
1048218897 8:132523151-132523173 CTTTGGAGTCAGATTCTCATGGG + Intergenic
1048386210 8:133914927-133914949 ATGTGGACACAAATTATACTTGG - Intergenic
1049052361 8:140208736-140208758 CCATGGACACAAAGTCTACTGGG + Intronic
1051505896 9:17827542-17827564 CTTTGGAGCCAAATTGTCCCAGG + Intergenic
1051958093 9:22722772-22722794 CCTTGGGCACAAATTCTTCCTGG - Intergenic
1052689174 9:31793692-31793714 CTAGAGAAACAAATTCTCCTGGG - Intergenic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1053170875 9:35882095-35882117 CATTTCACAAAAATTCTCCTGGG + Intergenic
1056261381 9:84852112-84852134 CCTTGGAAACAAAAGCTCCTGGG + Intronic
1056801785 9:89697154-89697176 ATTTGGTCAAACATTCTCCTGGG + Intergenic
1057108679 9:92446016-92446038 CTTCTGTCATAAATTCTCCTTGG + Intronic
1059275282 9:113090988-113091010 CTTTGGAAACAAATTTTCTATGG - Intergenic
1059894073 9:118839873-118839895 CCTTGGACAGAAATTGTCCCGGG + Intergenic
1185689407 X:2140799-2140821 CTTTGGAAACAACTTCGCATAGG + Intergenic
1186100649 X:6152613-6152635 CTTTGGACACAAATTCTCCTTGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1187005738 X:15231334-15231356 GTTTCGACACAAGTTCTCCAAGG + Intergenic
1187225083 X:17368000-17368022 CTTTGGGGACAACTTCACCTTGG - Intergenic
1192981623 X:76350465-76350487 GTCTGGACTCAAACTCTCCTTGG - Intergenic
1195252524 X:103063262-103063284 CTTTGGACTCCATTACTCCTAGG + Exonic
1195269599 X:103216144-103216166 CTTTGGACTCCATTACTCCTAGG - Exonic
1195278723 X:103309964-103309986 CTTTGGACTCCATTACTCCTAGG + Exonic
1198568178 X:137926815-137926837 CCCAGGACACAAATTTTCCTGGG - Intergenic
1200055532 X:153458031-153458053 CTTGTCACACAAATGCTCCTTGG + Intronic
1200625316 Y:5506351-5506373 CTATGGAGTCAAATTTTCCTGGG - Intronic