ID: 1186103474

View in Genome Browser
Species Human (GRCh38)
Location X:6181438-6181460
Sequence TCTTATAAGCAGCGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186103474_1186103477 13 Left 1186103474 X:6181438-6181460 CCTGTTTCCCGCTGCTTATAAGA 0: 1
1: 0
2: 0
3: 7
4: 187
Right 1186103477 X:6181474-6181496 TGAGTAACTTTATGAACAAAAGG 0: 1
1: 0
2: 0
3: 27
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186103474 Original CRISPR TCTTATAAGCAGCGGGAAAC AGG (reversed) Intronic
902570477 1:17343861-17343883 TTTTATCAGCAGCGTGAAAATGG + Intronic
906052350 1:42886294-42886316 TCATATAAGAAGAGGGAAAGAGG - Intergenic
907395398 1:54186106-54186128 CCTTATCAGCAGCGTGAAAACGG + Intronic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
910987087 1:93015953-93015975 ATTTATAAGCATGGGGAAACTGG - Intergenic
911360387 1:96868750-96868772 TCTTATAAGGTGAAGGAAACTGG + Intergenic
911889612 1:103351493-103351515 TCTTATAAGAAGGGGGCAAGAGG + Intergenic
912012421 1:104983998-104984020 TCTTATCAGCAGTGTGAAAATGG + Intergenic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
914987697 1:152474522-152474544 TTTTATCAGCAGCGTGAAAATGG - Intergenic
915604443 1:156941793-156941815 GCTTAAAAGCAGCAGGAAACAGG + Intronic
916672159 1:167031584-167031606 TCTTATAAGCAGCATGTTACTGG - Intergenic
919325834 1:196105608-196105630 TTTTATCAGCAGCGTGAAAATGG + Intergenic
920635077 1:207694453-207694475 TCTTGGAAGCAGAGGGAAAAAGG + Exonic
1063345270 10:5306224-5306246 TTTTATCAGCAGCGTGAAAACGG - Intergenic
1064852994 10:19731291-19731313 TTTTATAAGCAGGGAGAAAATGG + Intronic
1068399905 10:56515005-56515027 TGTTATAAGCAACAGAAAACAGG - Intergenic
1074968791 10:118518474-118518496 TTTTATAAGATGTGGGAAACAGG - Intergenic
1078320711 11:10332243-10332265 TCTTTAAAGCAGCGTGAAAACGG - Intronic
1079336381 11:19574172-19574194 TTTTGTAAGCAGTGGGAACCAGG - Intronic
1079839660 11:25381141-25381163 TCTTAGAAGCAGCTAGAAAAGGG - Intergenic
1079991994 11:27255949-27255971 CCTTATCAGCAGCGTGAAAATGG + Intergenic
1080038033 11:27729680-27729702 TTTTATAAGAAGAGAGAAACTGG + Intergenic
1080998029 11:37628754-37628776 TTTTGTAAGTAGCGAGAAACAGG + Intergenic
1083700373 11:64473507-64473529 TCTTATAAGCAGAGGAAATGTGG - Intergenic
1084361761 11:68673279-68673301 CTTTATGAGCAGCGGGAAAATGG - Intergenic
1086309490 11:85520001-85520023 TCTTATCAGCAGCATGAAAGTGG + Intronic
1086799997 11:91161475-91161497 ACTTACAAGCAGTGTGAAACTGG + Intergenic
1087696571 11:101384163-101384185 TCTTATCAGAAGAGGAAAACAGG - Intergenic
1087944377 11:104140488-104140510 TCTTTTAAACACAGGGAAACAGG + Intronic
1090036187 11:123251753-123251775 CCTTATAAGGAGGGGGAAATTGG + Intergenic
1090543153 11:127731015-127731037 TCTTATAAGCAGAGGAAATTTGG - Intergenic
1090644443 11:128756368-128756390 TCTTATAAGAAGAGGGAATTTGG - Intronic
1091730761 12:2878335-2878357 TCCTCTAAGCAGAGGGAATCAGG + Intronic
1091858777 12:3760054-3760076 TCTTATCAGCAGCATGAAAAGGG + Intronic
1092028809 12:5266318-5266340 TCTTATAAGTAGCAGTAAAAGGG - Intergenic
1093300207 12:17443878-17443900 TCTTATCAGCAGTGTGAAAATGG + Intergenic
1095786851 12:46119399-46119421 TCTTATATGGAGCTGGAAAGAGG + Intergenic
1100009339 12:89935056-89935078 TCTTAGAAGAATTGGGAAACTGG + Intergenic
1104234228 12:126917471-126917493 GCTTATGAACAGTGGGAAACTGG + Intergenic
1106116860 13:26825228-26825250 TCTTATCAGCAGTGTGAAAATGG - Intergenic
1107876252 13:44793340-44793362 TCTTTTAAGCAGTGTGAAAATGG - Intergenic
1109783707 13:67147198-67147220 TCTTATCAGCAGCTGAAAATAGG + Intronic
1111756083 13:92397497-92397519 TTTTATTAGCAGCGTGAAAACGG + Intronic
1111809996 13:93088359-93088381 TCTAATATCCAGCGGGAAAGAGG + Intergenic
1111811021 13:93095125-93095147 TCTAATATCCAGCGGGAAAGAGG + Intergenic
1114274203 14:21127346-21127368 TCTTATCAGCAGTGTGAAAATGG - Intergenic
1115006988 14:28498201-28498223 TTTTATAAGCAGCATGAAAGTGG - Intergenic
1115039416 14:28904721-28904743 TCTTATAAGCATAGAGATACAGG - Intergenic
1115268749 14:31527982-31528004 TCTTATAAGAAGAGGAAATCTGG - Intronic
1117861517 14:60096936-60096958 TCTTTTAATAAGTGGGAAACTGG + Intronic
1119032958 14:71206732-71206754 TCTTATCAGCAGCATGAAAACGG + Intergenic
1119969662 14:78955760-78955782 TCTTATAACCAGCAGAAAATAGG + Intronic
1120480905 14:85047852-85047874 CTTTATGAGCAGCGGGAAAATGG + Intergenic
1120661546 14:87256929-87256951 TCTTTTTAGCAGTGGGAAAATGG + Intergenic
1124223854 15:27872026-27872048 TTTTATAAGAAGCAGGAATCTGG - Intronic
1125344651 15:38706832-38706854 TCTTGTAAGCAGTGAGAGACTGG + Intergenic
1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG + Intergenic
1127145110 15:56015555-56015577 TCTTATAAGCAGCATGAAAGTGG - Intergenic
1127667476 15:61162819-61162841 ACTTGTAAGAAGCTGGAAACTGG - Intronic
1133360593 16:5170806-5170828 TTTTATCAGCAGCGTGAAAACGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134606179 16:15573061-15573083 TTTTATCAGCAGCGTGAAAATGG + Intronic
1135191978 16:20361864-20361886 TCTTCTAAGGAGCAGGAACCTGG + Intronic
1135813747 16:25613305-25613327 TTTTATCAGCAGCGTGAAAATGG - Intergenic
1136055582 16:27686491-27686513 TCTTATAAGCAGCACGTAATTGG + Intronic
1137409837 16:48218867-48218889 TTTTATCAGCAGCGTGAAAATGG + Intronic
1139127019 16:64090204-64090226 TGTTATAAGCAATAGGAAACAGG + Intergenic
1140948542 16:79794195-79794217 TCTTATCGGCAGCGTGAAATCGG - Intergenic
1142503330 17:346310-346332 CCTTATCAGCAGCGTGAAAACGG - Intronic
1144323271 17:14152179-14152201 TCTTATCAGCAGCATGAAAACGG - Intronic
1144538633 17:16115930-16115952 CTTTATAAGCAGCGTGAAAACGG - Intronic
1149308967 17:55375877-55375899 TTTTATCAGCAGCGTGAAAATGG - Intergenic
1151515297 17:74590343-74590365 CCTTATCAGCAGCGTGAAAATGG + Intronic
1154178123 18:12102217-12102239 TCAAATAAGCAGCTGGAAGCAGG + Intronic
1156583672 18:38408726-38408748 TTTTATCAGCAGCGTGAAAATGG + Intergenic
1157016236 18:43718333-43718355 TGTTATAAGCAACAGAAAACAGG - Intergenic
1158275830 18:55766363-55766385 TTTTATAAGCAGCGTGAGAACGG - Intergenic
1159595479 18:70378771-70378793 TCATAGAAGCAGAGGGAAAGGGG - Intergenic
1161286737 19:3472223-3472245 TCCTCTCTGCAGCGGGAAACGGG + Intergenic
1163369324 19:16893296-16893318 TCCTGTGAGCAGCGGGAACCTGG - Exonic
1165297033 19:34935814-34935836 TTTTATCAGCAGCGTGAAAATGG - Intronic
1165479232 19:36052341-36052363 TCTCATAAAAAGCGGGCAACTGG - Intronic
925650267 2:6081906-6081928 TTTTATAAGCATTAGGAAACTGG - Intergenic
926835219 2:17011774-17011796 TCTTAAAAGCTGAGGAAAACAGG + Intergenic
927747047 2:25632789-25632811 TCTTATAAGCAACAGAAAACAGG + Intronic
928876474 2:36045979-36046001 TCTGGTAAGCAGCAGGAAATTGG - Intergenic
930942226 2:57026687-57026709 TCTTACTAGCAGCGTGAAAATGG - Intergenic
936925033 2:117728102-117728124 TCTTAAAACCAGCTGGAAAAGGG + Intergenic
937677322 2:124606560-124606582 TTTTATCAGCAGCGTGAAAACGG - Intronic
939667908 2:144973191-144973213 TCATGTAAGCAGAGGGAAATAGG + Intergenic
941123619 2:161560778-161560800 TTTTATCAGCAGCGTGAAAATGG + Intronic
941140696 2:161777473-161777495 TTTTATCAGCAGCGTGAAAATGG - Intronic
941319742 2:164040384-164040406 TTTTATCAGCAGCGTGAAAATGG - Intergenic
943348864 2:186773631-186773653 TTTTATCAGCAGCGTGAAAAGGG - Intergenic
1169676219 20:8158371-8158393 TCTTATCAGCAGCATGAAAATGG - Intronic
1170172101 20:13426157-13426179 TATTAGAAGCTGCTGGAAACAGG + Intronic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1173019467 20:39255109-39255131 TCTTATAAGAAGAGGAAAATAGG - Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1174842176 20:53911035-53911057 TTTTATCAGCAGCGTGAAAACGG - Intergenic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1177026435 21:15926488-15926510 TTTTATCAGCAGCATGAAACTGG - Intergenic
1177718797 21:24877438-24877460 TCACATTAGCAGCGGGAAAGGGG + Intergenic
1185234052 22:49700812-49700834 TCTTTATAGCAGTGGGAAACTGG + Intergenic
949151119 3:768338-768360 TCTTATAGACAGCAAGAAACAGG - Intergenic
952001200 3:28787638-28787660 TGTTATAAGCAACAGAAAACAGG - Intergenic
952054893 3:29432400-29432422 TCTTATAGACAGTGGGAAATAGG + Intronic
952727750 3:36605974-36605996 TCTTATAAGCAAGGGTAAATCGG - Intergenic
957520621 3:81313839-81313861 TCTAATAAGCAGCATGAGACTGG - Intergenic
960356066 3:116655086-116655108 ACTAATAAGCAGGGGGAAAGAGG + Intronic
961214888 3:125151599-125151621 TCTGCTAAGCAGCCGGAAGCAGG - Intronic
962500310 3:135984751-135984773 TTTTATCAGCAGCGTGAAAATGG - Intronic
963569551 3:146975663-146975685 TTTTTTAAGCAGCAGGAAACAGG - Intergenic
963634529 3:147777370-147777392 CTTTATCAGCAGCGGGAAAATGG + Intergenic
964980857 3:162676998-162677020 TCTAATAAGCAGCTGTATACTGG - Intergenic
965203741 3:165693725-165693747 TCTTATCAGCAGCATGAAAATGG - Intergenic
967078448 3:186026364-186026386 TCTTATTAGCAGTGTGAAAAGGG + Intergenic
968576974 4:1371500-1371522 CCTTATCAGCAGCAGGAAAACGG - Intronic
970868003 4:20781423-20781445 CTTTATCAGCAGCGGGAAAATGG - Intronic
971914253 4:32848095-32848117 TCTTATGAGCAGCATGAAAATGG - Intergenic
973281021 4:48361480-48361502 TCTTAAGGGCAGAGGGAAACTGG + Intronic
974057374 4:56997609-56997631 TTATATAAGCAGAGAGAAACTGG + Intronic
974476075 4:62382306-62382328 CCTTATCAGCAGCAGGAAAAAGG - Intergenic
976503247 4:85815812-85815834 CTTTATCAGCAGCGGGAAAATGG - Intronic
977025927 4:91819968-91819990 CCTTATCAGCAGCAGGAAAATGG - Intergenic
978895172 4:113878276-113878298 TCTTATAAGCATTGTTAAACTGG + Intergenic
979367860 4:119847266-119847288 TTTTATCAGCAGCGTGAAAATGG - Intergenic
979810298 4:125028422-125028444 TTTTATTAGCAGCAGGAAAATGG - Intergenic
990429033 5:55716782-55716804 CTTTATCAGCAGCGGGAAAATGG + Intronic
990644701 5:57831051-57831073 CTTTATCAGCAGCGGGAAAACGG + Intergenic
991340442 5:65602611-65602633 CCTTATCAGCAGCGTGAAAATGG - Intronic
991937516 5:71816568-71816590 TCTTATAAGAAGAGGAAACCTGG - Intergenic
991939116 5:71833189-71833211 TCTTATAAGCTGTGGGACATTGG - Intergenic
995211944 5:109550757-109550779 TCTTATCAGCAGCATGAAAATGG + Intergenic
995597900 5:113766959-113766981 TTTTATCAGCAGCGTGAAAATGG + Intergenic
999380554 5:151118225-151118247 TCTTATAAGCAGCTTTAAAATGG - Intronic
999517932 5:152319759-152319781 TTTTGTAAGCAGCAGGAAAGAGG + Intergenic
999843575 5:155454447-155454469 TCTTATCACCAGGGGAAAACTGG - Intergenic
1003136493 6:3438533-3438555 TGTTGTCAGCAGCAGGAAACTGG - Intronic
1004309862 6:14535568-14535590 TTATATAAGCATTGGGAAACAGG - Intergenic
1007205980 6:40151575-40151597 ACTGATAAGCAGGGGGAGACAGG - Intergenic
1009046180 6:58240062-58240084 TCTTATATCCAGGGGGAGACAGG + Intergenic
1009221990 6:60994367-60994389 TCTTATATCCAGGGGGAGACAGG + Intergenic
1009263505 6:61525596-61525618 TCTTATAAGAAGAGGAAATCTGG - Intergenic
1010264749 6:73853291-73853313 TCTTATAAGAAGCAGAAATCAGG - Intergenic
1011121973 6:83964090-83964112 TTTTATCAGCAGCGTGAAAATGG + Exonic
1011349121 6:86402841-86402863 TCTTATTAGCAGTGTGAAAATGG - Intergenic
1014153285 6:118083444-118083466 TCTTATAAGCACCACTAAACAGG - Intronic
1014501528 6:122196207-122196229 TTTTTTAAGCAGCAGGAATCTGG + Intergenic
1015312085 6:131777234-131777256 TCTGATAAGCACAGGGAGACAGG - Intergenic
1017070350 6:150570539-150570561 TCTCATAAGCAGCTGGGCACAGG - Intergenic
1018908726 6:168089797-168089819 TCCTAAAATCAGCGGGAAGCCGG + Intergenic
1020537713 7:9423245-9423267 TCTTATCAGCAGCATGAAAATGG - Intergenic
1021191683 7:17627715-17627737 TTTTATAAATAGGGGGAAACTGG - Intergenic
1022492723 7:30833190-30833212 TTTTATCAGCAGCGTGAAAATGG - Intronic
1024311447 7:47973227-47973249 TCTTTTTAGCAGCGTGAAAACGG + Intronic
1026640360 7:72119152-72119174 CTTTATAAGCAGCGTGAAAATGG - Intronic
1028189058 7:87824499-87824521 TCTTATCAGCAGTGTGAAAGTGG + Intronic
1028189317 7:87826446-87826468 CCTTATCAGCAGCGTGAAAATGG + Intronic
1030737739 7:113069655-113069677 TCTTATCAGCAGCATGAAAACGG - Intergenic
1030854632 7:114539648-114539670 TCTTAAAAGCAGCATGAAATAGG + Intronic
1032179036 7:129659928-129659950 TCTTATCAGCAGCATGAAAATGG - Intronic
1032440585 7:131940164-131940186 CCTTATCAGCAGCGTGAAAACGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1035426676 7:158782544-158782566 TGTGAGAAGCAGCGGGAAAGTGG + Intronic
1039037911 8:33379242-33379264 CTTTATAAGCAGTGGGAAAATGG + Intronic
1040466658 8:47701832-47701854 TCTCTTAAGCAGCGGGTAACTGG - Exonic
1042458994 8:69040203-69040225 TCTTATAGGCAGAGAGAACCTGG - Intergenic
1043571841 8:81612621-81612643 TGTTATAAGCAACAGAAAACAGG + Intergenic
1043620710 8:82188970-82188992 ACTTCTAATCAGCAGGAAACAGG + Intergenic
1044072832 8:87784148-87784170 TCTTATCAGCAGCATGAAAATGG - Intergenic
1044227296 8:89734235-89734257 TTTTATCAGCAGCGTGAAAACGG - Intergenic
1044887297 8:96793233-96793255 CTTTATAAGCAGCGTGAAAATGG - Intronic
1046561612 8:115845041-115845063 TTTTATCAGCAGCGTGAAAATGG - Intergenic
1048309005 8:133303892-133303914 TCTTAGCAGCAGATGGAAACAGG - Intergenic
1048430342 8:134364675-134364697 CTTTATAAGCAGCGTGAAAATGG - Intergenic
1048772617 8:137911930-137911952 TTTTATCAGCAGCGTGAAAATGG - Intergenic
1050828944 9:9987304-9987326 TCTTATCAGCAGTGTGAAAATGG - Intronic
1051573104 9:18583066-18583088 GTTTATAAGCAGCGTGAAAATGG + Intronic
1052023798 9:23553449-23553471 TCTTAGAGGCAGTGGGACACAGG - Intergenic
1052672748 9:31578744-31578766 TTTTATCAGCAGCGTGAAAATGG + Intergenic
1057617218 9:96602414-96602436 CCTTATCAGCAGCGTGAAAACGG - Intronic
1060178187 9:121513244-121513266 TCTCATCAGCAGCGTGAAAATGG - Intergenic
1061357016 9:130113529-130113551 TCTTATAAGAACTGGGAAACTGG - Intronic
1185645389 X:1611931-1611953 TCTTATCAGCAGCATGAAAATGG + Intergenic
1186103474 X:6181438-6181460 TCTTATAAGCAGCGGGAAACAGG - Intronic
1189132761 X:38517586-38517608 CTTTATCAGCAGCGGGAAAATGG - Intronic
1189660182 X:43287971-43287993 TCTCTTAAGCAGAGGGAATCTGG - Intergenic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1192828399 X:74724046-74724068 TCTGATATGGAGCTGGAAACAGG + Intergenic
1194216543 X:91135818-91135840 TATTATAAGCAGTGTGAAAGTGG + Intergenic
1194566311 X:95493538-95493560 CTTTATCAGCAGCGTGAAACTGG + Intergenic
1198788394 X:140315842-140315864 CCCTATCAGCAGCGGGAAATCGG - Intergenic
1199573804 X:149293373-149293395 TCTTATAAGAAGGTGGAAACTGG - Intergenic