ID: 1186104432

View in Genome Browser
Species Human (GRCh38)
Location X:6191261-6191283
Sequence GGGTAGAACTTCAGTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186104426_1186104432 2 Left 1186104426 X:6191236-6191258 CCATCAACTCATGCAACACAGGA 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 155
1186104424_1186104432 27 Left 1186104424 X:6191211-6191233 CCAATAATTATTTTTTCAAAATT 0: 1
1: 0
2: 19
3: 278
4: 2252
Right 1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186104432 Original CRISPR GGGTAGAACTTCAGTAAGGA GGG Intronic
904543983 1:31254013-31254035 GGCTAGAACTATAGTCAGGAGGG - Intergenic
906559875 1:46748621-46748643 GGGTGGAACATCAGTGAGAAAGG - Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
909786125 1:79616440-79616462 AGGTAGAATTCCAGTAACGAAGG + Intergenic
913274419 1:117122903-117122925 GGGTACAAATTAAGTAGGGAAGG - Intergenic
920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG + Intergenic
920631213 1:207654389-207654411 GGTTAGAACTTCTTTTAGGAGGG - Intronic
920641741 1:207758841-207758863 GGTTAGAACTTCTTTTAGGAAGG - Intronic
921402733 1:214744099-214744121 GGGAAGAACATGAGGAAGGAAGG - Intergenic
922094576 1:222432073-222432095 GAGAAGAACTTGAGTAAGGAAGG - Intergenic
922135384 1:222820147-222820169 GGGCAGATTTTCTGTAAGGAGGG + Intergenic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1064310140 10:14205014-14205036 AGGCAGAACTTTGGTAAGGAAGG - Intronic
1064886028 10:20113577-20113599 GTGTAGAAAATGAGTAAGGAGGG - Intronic
1071530581 10:86388118-86388140 GGCTTGAGCTTCAGAAAGGATGG - Intergenic
1071944200 10:90623180-90623202 GGGTAGAACTTCATAAGGCATGG - Intergenic
1073617112 10:105007146-105007168 AGGTAGAACTTCAGGATGAAAGG - Intronic
1077461284 11:2712014-2712036 GGGTAGAGATTCAGCAAGGCTGG - Intronic
1080280243 11:30548640-30548662 GGGTAGATCTTCACAAAAGAAGG + Intronic
1086119951 11:83295300-83295322 GGGAACAATTTCAGCAAGGAAGG - Intergenic
1088568695 11:111199792-111199814 GGTTATAACTTCAGTATGGTAGG - Intergenic
1090535998 11:127642418-127642440 GGGTAGAACTTGGGTAATGTTGG - Intergenic
1094499032 12:31006942-31006964 GGGTAGAAGCTCAGGAGGGAGGG - Intergenic
1095099345 12:38164131-38164153 AGGGAGTACTTCAGTCAGGAAGG - Intergenic
1098350015 12:69548866-69548888 TACTAGAACCTCAGTAAGGAAGG + Intronic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1099388994 12:82055289-82055311 GGGTAGAACTTCAGTGAACTTGG - Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1106005476 13:25766138-25766160 AGGTGGAACCTCACTAAGGAGGG - Intronic
1106290699 13:28358844-28358866 GGGAAGGAGATCAGTAAGGAAGG + Intronic
1106816579 13:33414939-33414961 GGGTAGAATGTCTGTAAAGATGG + Intergenic
1108428036 13:50325036-50325058 GAGTGGAACTTAAGTAAAGAGGG - Intronic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1112303808 13:98255072-98255094 GGGTAAAACAACAGTAGGGAGGG + Intronic
1112356190 13:98676484-98676506 AGGTTGAACTTCAGTAAGTCCGG - Intergenic
1114229650 14:20768932-20768954 GGTTAGAGATTCAGTAAGGGCGG + Intronic
1122442209 14:101739883-101739905 GGGTGGAACTTCAGTAGGTGAGG + Intergenic
1123479586 15:20618464-20618486 GGGTAGGAGTTCAGTATGAAGGG - Intergenic
1123638421 15:22381900-22381922 GGGTAGGAGTTCAGTATGAAGGG + Intergenic
1123837292 15:24208952-24208974 GGGTAAAAGTTCAGTGAGGATGG + Intergenic
1123846500 15:24308718-24308740 GGGTAAAAGTTCAGTCAGGATGG + Intergenic
1123865506 15:24515770-24515792 GGGTAAAAGTTCAGTCAGGATGG + Intergenic
1124186913 15:27538818-27538840 GGATCGAACTTCAGTAAGTGAGG - Exonic
1126812977 15:52426904-52426926 GGGAAGAAAGACAGTAAGGAGGG + Intronic
1126813007 15:52427433-52427455 GGGAAGAAACACAGTAAGGAGGG + Intronic
1126829235 15:52583108-52583130 GTGAAAAACTTCAGAAAGGAGGG - Intronic
1129298698 15:74613481-74613503 GGGTAGAATCTCAGGCAGGATGG + Intronic
1132006189 15:98229542-98229564 GAGTAGAAATTCAGTGAGCATGG + Intergenic
1133601209 16:7341998-7342020 GGGGAGAATTGCAGTGAGGAGGG + Intronic
1137376278 16:47954859-47954881 GGGTAGATGATCAGTAAAGATGG - Intergenic
1141765395 16:86055026-86055048 GGGTGGAACTTCCCTATGGAAGG + Intergenic
1142300574 16:89255559-89255581 GGGTAGAAGTTCAGCAACGCAGG + Intergenic
1142320809 16:89381749-89381771 GTGTATAAATTCGGTAAGGAGGG - Intronic
1143662437 17:8334244-8334266 GGGAAGAAAGTCAGTAAGGTGGG + Intergenic
1143906631 17:10214367-10214389 GGGCAGAACTTCAGGAATTAGGG + Intergenic
1148026372 17:44591713-44591735 GGGTAGAGATTCAGGCAGGAAGG - Intergenic
1149644414 17:58229362-58229384 GGGTAGGACTGCAGAGAGGAAGG - Intronic
1150643947 17:66966437-66966459 GGTTGGAACTGCAGTAAGGAAGG - Intronic
1155079608 18:22395539-22395561 AGCTAGGCCTTCAGTAAGGATGG - Intergenic
1155522960 18:26687580-26687602 GGCTAGGATTTCAGTAAGCAAGG + Intergenic
1156267327 18:35500459-35500481 GGGAAGAATTTCAGAAAGAAAGG - Intergenic
1158279574 18:55807865-55807887 GGTTACAACTCCAGTAAGCAAGG - Intergenic
1158410222 18:57198862-57198884 GGGGAGAGGTTCAGAAAGGAGGG - Intergenic
1158933437 18:62343173-62343195 GGCTATAACTTCAGTAAGGATGG - Intronic
1159248859 18:65847583-65847605 GGGTGGTACTTCAGTAAAGTAGG - Intronic
1160395542 18:78568544-78568566 GGTTGGAACTTCAGATAGGAAGG + Intergenic
1163425163 19:17236771-17236793 GGGGGGACCTACAGTAAGGAGGG + Intronic
1166138405 19:40791503-40791525 GGGAAGAACTTCAGTGTGGCTGG - Intronic
927657843 2:24966219-24966241 GGGTAGCAGTTCAGCATGGATGG + Intronic
928315637 2:30243045-30243067 GGGTAGAACATCTATAAAGATGG + Intronic
929109352 2:38393336-38393358 GGGTATAACTAAAGTAATGAAGG + Intergenic
930575485 2:53141922-53141944 GGGTAGAAGAGCAGAAAGGAGGG - Intergenic
930888437 2:56355212-56355234 GGGTAGAACCCAAGTAAGGGTGG - Intronic
932766787 2:74475475-74475497 GGGTAGGATTTCAGGAGGGAAGG + Intronic
937023376 2:118678565-118678587 TGGTGGAACTTCATTAAGGCTGG - Intergenic
937238549 2:120445458-120445480 GGTTAGAACATCAGGAAGGTTGG + Intergenic
937605058 2:123790109-123790131 GGGTAGAAAATCAGGAAGTATGG + Intergenic
939521090 2:143231637-143231659 TGGAAGAACTTCAGTGAGAAAGG - Intronic
941329585 2:164163919-164163941 GGGTAGAACTTCTGTAACACAGG - Intergenic
941401529 2:165037193-165037215 TGAGAGAACTTCAGTAAGCAGGG + Intergenic
941938865 2:171011506-171011528 GAGTAGAACTTCAGTGTAGAAGG - Intronic
943127266 2:183810179-183810201 GGGTAATACTTCAGGAAGCAAGG - Intergenic
947135480 2:226973078-226973100 GGGAGGAACTTCTGTGAGGAAGG - Intronic
947621616 2:231594476-231594498 GGGTGGAGGTTCAGTAGGGATGG - Intergenic
947753978 2:232547675-232547697 GGGGAGAACTTCAATCAGGGAGG + Intergenic
948393075 2:237626613-237626635 GGGGAGAACTTCAGTGTGGCTGG - Intergenic
948857308 2:240736050-240736072 GCTTAGCACTGCAGTAAGGAGGG - Intronic
1169155419 20:3325500-3325522 GGATACAAGTTCAGTGAGGAGGG + Intronic
1169902044 20:10562856-10562878 GAGTAGCACTGCAGTAAGCAAGG + Intronic
1174402712 20:50284470-50284492 AGGGAGGAATTCAGTAAGGAGGG - Intergenic
1176163303 20:63659539-63659561 GGGTGGAGCTTCAGCCAGGACGG + Intronic
1179204447 21:39261267-39261289 GGGTAGAACTCCACTACTGAGGG + Intronic
1181471050 22:23140141-23140163 GGGTAGAACTTCAGTAATAAGGG - Intronic
1181582857 22:23837555-23837577 GAGGAGAACTCCAGCAAGGATGG + Intronic
1183772703 22:39940202-39940224 TGGTAGACATTCAGTAAGAAGGG + Intronic
1184739579 22:46419608-46419630 GGAGAAAACTTCAGGAAGGATGG + Intronic
1184822338 22:46918585-46918607 GGGGACAACTTCAGGAAGGAGGG + Intronic
949599775 3:5585223-5585245 GGGTAGAATTTGAGGAAGGGAGG + Intergenic
952181591 3:30922072-30922094 GGTTAGAACTTCTGGAACGAAGG - Intergenic
957472557 3:80678203-80678225 GGGGAGAACTGCAGTAAGAGGGG + Intergenic
959454650 3:106543698-106543720 GGGTAAAATTTCAGTCAAGATGG - Intergenic
960279981 3:115770377-115770399 TGGTAGAACTTCCTTAAGGAAGG + Intergenic
963185577 3:142412122-142412144 GGACAAAAATTCAGTAAGGATGG - Intronic
964266869 3:154907428-154907450 AGGTAGAAAATCAGTAAGGAAGG + Intergenic
966875136 3:184317309-184317331 GGGTAGAAGTGCTGTCAGGAGGG - Exonic
967492104 3:190104414-190104436 GGGAAGAACTTCAAAGAGGAGGG + Intronic
968249443 3:197193707-197193729 TGGTAGAACTTTAATAAGAAAGG + Intronic
974667901 4:64989105-64989127 ATGTAGAACTTCAGTAAGGTAGG - Intergenic
980560309 4:134464093-134464115 GGGTAAAGCAACAGTAAGGAGGG + Intergenic
983091271 4:163505614-163505636 GGTGAGAAGTTCAGTAAGAATGG + Intronic
984176342 4:176422844-176422866 GGGCAGAACTTCTGCCAGGATGG - Intergenic
986152762 5:5142391-5142413 GGCTAGAACTTCACTAAGAAGGG - Intronic
987099910 5:14582180-14582202 GGGTAGCACTTGAATAAGGGAGG + Intronic
987642199 5:20627259-20627281 TGATAGATCTTCAGTAATGAAGG - Intergenic
988400892 5:30759020-30759042 GTGTAGAATTTCTATAAGGAAGG + Intergenic
988927430 5:36003787-36003809 CAGTTGAACTTCAGTATGGAAGG + Intergenic
989122574 5:38019094-38019116 GGATAGAAGTTGACTAAGGAAGG - Intergenic
989629492 5:43466503-43466525 AGGGAGAACTTCAGTCAGAAAGG + Intronic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
991627727 5:68621719-68621741 AGGTAGAACTTCAGAAAGGCAGG - Intergenic
994678791 5:102860151-102860173 GGGTAGAAATTGAGGAAGGGTGG + Intronic
995359823 5:111282642-111282664 AGGAAGAACTTAAGTAAGAATGG - Intronic
995516181 5:112956154-112956176 AATCAGAACTTCAGTAAGGAGGG + Intergenic
996303091 5:122011741-122011763 GGGAAGAAGTTAAGTGAGGAAGG + Intronic
996790523 5:127289477-127289499 GGGTGGAAGGTCAGTCAGGATGG - Intergenic
997792128 5:136770594-136770616 GGGAAGGACTCCAGGAAGGAGGG + Intergenic
998314002 5:141163065-141163087 AGAGAGAAATTCAGTAAGGATGG + Intergenic
1000841645 5:166226867-166226889 GGGTGACACTTCAGCAAGGAAGG + Intergenic
1000982611 5:167832622-167832644 TGGAAGAATGTCAGTAAGGATGG + Intronic
1004900072 6:20185394-20185416 CAGTAGAATTTCAGTAAGGCAGG + Intronic
1006609965 6:35288557-35288579 GGGTAAAACTGCTGGAAGGAAGG - Intronic
1007361098 6:41356443-41356465 GGGAAGAACAGAAGTAAGGAAGG - Intergenic
1008889585 6:56472229-56472251 AGGTATAACTTCGGTTAGGATGG + Intronic
1009632867 6:66221752-66221774 GGTTTGAACTTCAGTCAGGTAGG + Intergenic
1011192412 6:84744649-84744671 GGGAAGAACTTCAGTTCAGAGGG - Intronic
1012402336 6:98852207-98852229 GGGTAGAGTTTCAGTTAGAAAGG + Intergenic
1013020381 6:106209524-106209546 GGGAAGAAATGCAGTAAGGTAGG + Intronic
1014316001 6:119865437-119865459 TTGTAGAACCTCAGAAAGGAAGG + Intergenic
1014371139 6:120609014-120609036 GGGTAGAACTGGAATGAGGAAGG - Intergenic
1014666641 6:124246201-124246223 GGAAAGAACTGCAGTAAGAATGG - Intronic
1021351598 7:19600973-19600995 GTTTAGAACTTCCCTAAGGAGGG + Intergenic
1021420898 7:20443595-20443617 GGGTAGCACTAAAGTAAGGATGG + Intergenic
1023851206 7:44151487-44151509 GGGCTGGTCTTCAGTAAGGATGG - Intronic
1024425833 7:49225764-49225786 AGGTAAAACTTCAGAAAGGCTGG - Intergenic
1024924371 7:54597747-54597769 GGGTAGAATTTCAGAAAACAAGG + Intergenic
1029248316 7:99218470-99218492 GGGGAGTACTTCAGGAAGGAGGG + Intergenic
1030468822 7:109937823-109937845 GGGTAGAAGTTCAGGCTGGAAGG + Intergenic
1030631606 7:111901743-111901765 GGGGAGAATTTGAGAAAGGAGGG - Exonic
1031434459 7:121715130-121715152 GGGCAGTGTTTCAGTAAGGAAGG + Intergenic
1033575007 7:142672646-142672668 GGCTAAGAGTTCAGTAAGGAGGG - Intergenic
1036732026 8:11274150-11274172 GGGGAGAAGGTAAGTAAGGAAGG + Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1038036163 8:23688606-23688628 GGGGAGAATGTCAATAAGGAAGG - Intergenic
1042988629 8:74613089-74613111 GGGTAGAGGTTCAGTTATGAGGG + Intronic
1043380850 8:79700515-79700537 GGGAAGAACTGCAGTAGGGTGGG + Intergenic
1045541245 8:103087890-103087912 GGGTAGAAATCCTGTAAGTAGGG - Intergenic
1050608590 9:7327625-7327647 GGGTAGAACTGATGTAAGAATGG - Intergenic
1055534144 9:77219027-77219049 TGGTGGAACTTCAGTAAGGTGGG + Intronic
1055876108 9:80943438-80943460 AGGTAGAAAAACAGTAAGGATGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1060250353 9:121982043-121982065 GGGCAGAATTACAGAAAGGAAGG - Intronic
1060645203 9:125272713-125272735 GGGTAGAACCACAGTAATGATGG + Intronic
1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG + Intronic
1187458840 X:19467244-19467266 GAGTAGAACTTCAGTCAGTCTGG - Intronic
1188536622 X:31203690-31203712 GGGAAGAAGTTCAGCAAGGGAGG - Intronic
1188989816 X:36803764-36803786 AGGTATAAATTCAGGAAGGAAGG - Intergenic
1193974500 X:88100426-88100448 GGGGAGAACTTAAGTAGGGGAGG + Intergenic
1195270456 X:103223902-103223924 TGGCAGAATTTCAGTAAGAATGG - Intergenic
1197802789 X:130369567-130369589 GGGAACTACTTCAGCAAGGATGG + Intronic
1198380500 X:136078723-136078745 GGGGAGAATTTCAGTGAGGTGGG - Intergenic
1200287021 X:154832824-154832846 GGATAGAACTACTGCAAGGATGG - Intronic
1201254241 Y:12091383-12091405 TGGTAGACCTTCAGTGAGGCTGG + Intergenic
1201944827 Y:19500574-19500596 GGGTAGAAAACCAGTAAGGGTGG + Intergenic