ID: 1186107672

View in Genome Browser
Species Human (GRCh38)
Location X:6225595-6225617
Sequence CAGTTTGTGTGGGCGTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186107672_1186107677 5 Left 1186107672 X:6225595-6225617 CCGCAGAACGCCCACACAAACTG 0: 1
1: 1
2: 0
3: 4
4: 122
Right 1186107677 X:6225623-6225645 TCTGCTTCGTCAGGATAACGAGG 0: 1
1: 0
2: 0
3: 4
4: 54
1186107672_1186107676 -4 Left 1186107672 X:6225595-6225617 CCGCAGAACGCCCACACAAACTG 0: 1
1: 1
2: 0
3: 4
4: 122
Right 1186107676 X:6225614-6225636 ACTGGCAATTCTGCTTCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186107672 Original CRISPR CAGTTTGTGTGGGCGTTCTG CGG (reversed) Intronic
900436817 1:2634875-2634897 CAGTCTGTGTGGGTGTTTGGGGG - Intergenic
900436857 1:2635020-2635042 CAGTCTGTGTGGGTGTTTGGGGG - Intergenic
900436876 1:2635091-2635113 CAGTCTGTGTGGGTGTTTGGGGG - Intergenic
905171393 1:36111868-36111890 CAGTTTGGGTGGGATCTCTGAGG - Intronic
907243974 1:53095636-53095658 CAGGTTGTGTGAGTGTACTGAGG - Intronic
907244012 1:53095914-53095936 CAGTTTGTGTGAGTGTACCGAGG - Intronic
907244128 1:53096827-53096849 CAGGGTGTGTGAGTGTTCTGAGG - Intronic
907244160 1:53097072-53097094 CAGTGTGTGTGAGCGTACTGAGG - Intronic
907244251 1:53097704-53097726 CAGGTGGTGTGGGTGTACTGTGG - Intronic
907244617 1:53100584-53100606 CAGGTTGTGTGAGTGTACTGAGG - Intronic
908659550 1:66422159-66422181 AAGTTTGGATGGGTGTTCTGCGG + Intergenic
909880170 1:80865535-80865557 GAGATTTTGTGGGCATTCTGAGG + Intergenic
913329926 1:117658852-117658874 CAGTGTGTGTTGTGGTTCTGTGG + Intergenic
917019166 1:170567783-170567805 CAACTTGTCTGGGCCTTCTGTGG - Intergenic
1062828930 10:592281-592303 CAGTTTGTGTGGCTGTAATGAGG + Intronic
1067414510 10:46093250-46093272 TAGTTTGTGTGTGCATTCAGTGG - Intergenic
1067559944 10:47298316-47298338 CAGCTTGTGCGGGCCTCCTGCGG + Intergenic
1067772807 10:49139458-49139480 CTATTTGTGTGGGCACTCTGAGG - Intergenic
1067943209 10:50673819-50673841 GAGTTTGTGTGTGCGTTCAAGGG - Intergenic
1069761409 10:70814199-70814221 GAGTTTGTGTGGGAGTTTGGAGG - Intergenic
1071523854 10:86347036-86347058 CAGTTAGGGTAGGCTTTCTGGGG - Intronic
1072099861 10:92218657-92218679 CAGTTTATGTTGGCCTACTGTGG - Intronic
1074497291 10:113991322-113991344 CGGCTTCTGTGGGTGTTCTGCGG + Intergenic
1076104651 10:127811701-127811723 AAGTGTGTGTGGTAGTTCTGAGG + Intergenic
1078072707 11:8128178-8128200 CACTTTGTGTGAGGCTTCTGGGG + Intronic
1081766696 11:45616121-45616143 CACTTTGGGTGGGGGTTCTTTGG - Intergenic
1082998909 11:59274172-59274194 CCTTTTCTGTGGGCGTTCTAGGG - Intergenic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1085481095 11:76823661-76823683 CTGTGTGTGTGTGCGTGCTGGGG - Intergenic
1092157761 12:6295435-6295457 CATTCTGTCTGGGAGTTCTGGGG - Intergenic
1093209263 12:16288359-16288381 AAGTTTATGTGGGCTTTCTCAGG - Intergenic
1097509953 12:60527047-60527069 CAGATTGTGTGGTATTTCTGTGG + Intergenic
1098114985 12:67165587-67165609 CACTTGGTGTGGGGGATCTGGGG - Intergenic
1098578170 12:72068486-72068508 CATTTAGTGTGGGAGTGCTGTGG + Intronic
1099304347 12:80936731-80936753 GAGCTTGTGAGGGCGTCCTGGGG + Intronic
1108710364 13:53027264-53027286 GAGTTTGTGTGGAGCTTCTGGGG + Intergenic
1109463824 13:62700625-62700647 CAGTTTGTGTGGAGGTCCAGGGG - Intergenic
1112018682 13:95352802-95352824 CAGTTTGTTTGAGCCTTCAGAGG - Intergenic
1112489008 13:99845212-99845234 CAGATTGTGTGGACGTTCAACGG - Intronic
1118316172 14:64727540-64727562 CTGTTTCTGTGGGCATTCAGAGG + Intronic
1121541189 14:94728021-94728043 CGGTGTGTGTGGGTGTTCTCTGG + Intergenic
1121796036 14:96736015-96736037 CAGTGTGGGTGGGAGCTCTGCGG + Intergenic
1122881031 14:104690453-104690475 CTGTCTGTCTGGGCCTTCTGGGG + Intronic
1126468197 15:48979840-48979862 CAGTTTGTGAGGGAGATCGGAGG - Intergenic
1126529262 15:49694240-49694262 CGGTTTGTTTGGGAGTTGTGTGG - Intergenic
1133196208 16:4172573-4172595 CACTTTGTGTGGCCTTCCTGGGG - Intergenic
1141815294 16:86405331-86405353 CAGCTTGTGTGTGCCTTCAGGGG + Intergenic
1144778409 17:17796178-17796200 CAGTTTGTCTGGGGGTGCAGGGG - Exonic
1146397779 17:32482547-32482569 AAGTTGGTGTGTGAGTTCTGAGG + Exonic
1151440522 17:74125975-74125997 CAGTTTGGGTAGGCGTGGTGGGG - Intergenic
1152854644 17:82657891-82657913 CAGTTTTTGGGGGGGCTCTGGGG + Exonic
1153367767 18:4277468-4277490 TAGTTTCTGTGGGTTTTCTGTGG + Intronic
1155434668 18:25799590-25799612 CATTTTCTGTTGGAGTTCTGTGG - Intergenic
1157247993 18:46071081-46071103 GAGTTTGTGAGGTCCTTCTGGGG - Intronic
1158167979 18:54563189-54563211 TAGTCTGTCTGGGAGTTCTGAGG - Intergenic
1164674714 19:30093477-30093499 CAGTTTCTGTGCGCATTCTTCGG + Intergenic
931573652 2:63697173-63697195 CAGGTAGTGTGGGCTTTATGGGG - Intronic
937873266 2:126801661-126801683 CAGTCTGTTTGGGGGTCCTGGGG - Intergenic
939434070 2:142150774-142150796 CAGTTATTGTAGGCGTTATGTGG + Intergenic
944315291 2:198278218-198278240 AAGTGTGTGTGAACGTTCTGGGG - Intronic
944814525 2:203362380-203362402 CATGTTGTTTGGACGTTCTGGGG + Intronic
946690716 2:222306566-222306588 CAGTTTTTCGGGGCGTCCTGGGG - Intergenic
947816672 2:233041993-233042015 CAGTTGGGGTGGGCTTCCTGAGG + Intergenic
1175282913 20:57816357-57816379 CAGTTTGTGTGTTCCTTTTGAGG + Intergenic
1176375300 21:6084056-6084078 CATTTTGGGTGGGAGTGCTGGGG - Intergenic
1179748174 21:43454188-43454210 CATTTTGGGTGGGAGTGCTGGGG + Intergenic
1181451022 22:23021073-23021095 CACTTTTTGTGTGTGTTCTGGGG - Intergenic
1181983498 22:26783016-26783038 CAGTTTGTGATGGCTTCCTGGGG + Intergenic
1182287514 22:29257136-29257158 CAGTGGGTGTGGGACTTCTGAGG - Intronic
1182711852 22:32328137-32328159 CAGTTGGTGTGTGTGTGCTGGGG - Intergenic
1185350875 22:50337148-50337170 CAGTGTGTGTGTGCGATGTGTGG + Intergenic
950877201 3:16287019-16287041 TGATTTGTGTGGGGGTTCTGGGG - Intronic
951269593 3:20608204-20608226 CAGTTTGTGTGGGAGCTGGGTGG + Intergenic
958466212 3:94462368-94462390 GAGTTTGTGTGTGCATGCTGGGG + Intergenic
959557484 3:107738774-107738796 CATTTTGTGAGTGCTTTCTGGGG + Intronic
969438396 4:7201770-7201792 TAGTTTGGGTGGGTGCTCTGTGG + Intronic
969444372 4:7235664-7235686 CTGTTTGTGTGGCCGTTGAGAGG + Intronic
971139701 4:23910942-23910964 CAGTTTGGGTGGGGGTTGAGGGG - Intergenic
981440363 4:144775573-144775595 CAGTTTGTGGGGGACATCTGAGG + Intergenic
985644198 5:1077426-1077448 CAGTGTGTGTGGCTGCTCTGAGG - Intronic
985688024 5:1292353-1292375 CAGTGTTTGTGGGTGTTCAGGGG - Intronic
989128826 5:38083794-38083816 CAGTTTGTGTAGGCATTTTGAGG + Intergenic
989250113 5:39303753-39303775 ATGTTTGTGTGGGCTTTCTCTGG + Intronic
993749346 5:91647965-91647987 CAGTTGTTGTGGTGGTTCTGAGG + Intergenic
996360857 5:122644335-122644357 CAGTTTGTGTGGGGGACGTGGGG + Intergenic
999178935 5:149655011-149655033 CAGTGTGTGTGTGCGGTGTGTGG - Intergenic
1000995056 5:167950308-167950330 CAGCTTGTGTGGCCCTTGTGAGG - Intronic
1002346004 5:178547778-178547800 CAGTGTGTGTGGGGGGTGTGTGG - Intronic
1002458649 5:179361328-179361350 GTTTTTGTGTGTGCGTTCTGGGG + Intergenic
1008268631 6:49463201-49463223 CGGTTTGTGTGGGCTTGGTGAGG - Intergenic
1011228502 6:85134152-85134174 AAGTTTTTGTGGGTGTACTGGGG - Intergenic
1011536276 6:88379685-88379707 CAGGTTTTGCGGGGGTTCTGGGG + Intergenic
1011823334 6:91277862-91277884 AAGTTTCTGTGGACGTTCTAGGG - Intergenic
1012541937 6:100371405-100371427 CAGTGTGTGTGGGTGTAGTGTGG - Intergenic
1014886258 6:126785044-126785066 CATTTTGTGTGGACTTTCCGGGG - Intergenic
1016072610 6:139757942-139757964 CAATTTGTGTGAGGTTTCTGAGG + Intergenic
1017728425 6:157292723-157292745 GAGTATGTGTGTGCGTGCTGGGG - Exonic
1018981771 6:168607000-168607022 AAGTTGGTGTGGGCTGTCTGGGG + Intronic
1021281647 7:18727209-18727231 CACGTTGTGTGGCAGTTCTGGGG + Intronic
1027532639 7:79354480-79354502 AAGTTTGTGTGTGGGTTCTATGG - Intronic
1029101980 7:98138565-98138587 CAGTGTGTGTAGGGGTTCTAAGG - Intronic
1031483277 7:122302819-122302841 CCGTTTGTGTGTGAATTCTGTGG - Exonic
1036122626 8:6034952-6034974 CATTTTGGGTGGGCTTTCTAGGG - Intergenic
1037973515 8:23192167-23192189 CAGTGTGGGTGGGCTCTCTGTGG - Intronic
1038295417 8:26287573-26287595 CAGGGTGTGTGGGAGTGCTGGGG + Intergenic
1038808586 8:30817194-30817216 CAGATTTTGTGGGAGTTCTGTGG + Intergenic
1042960634 8:74300390-74300412 AAGCTTGTGTGTGCGTTGTGGGG + Intronic
1045185941 8:99838134-99838156 AAGTTGCTGTGGGCTTTCTGTGG + Intronic
1045246976 8:100450985-100451007 CAGATTGTGTGAGGGTTCTCTGG - Intergenic
1046080621 8:109366166-109366188 TCTTTTGTGTGGACGTTCTGAGG + Intronic
1047422603 8:124719441-124719463 AAGATTGTGTGGGGGCTCTGGGG - Intronic
1047689552 8:127337634-127337656 CAGCATGTGTAGGCGATCTGAGG - Intergenic
1049675731 8:143888075-143888097 CAGTTTGAGTTGGGTTTCTGGGG - Intergenic
1050281665 9:4056720-4056742 TAGTTTGTGTGTGCGTGGTGGGG - Intronic
1050332090 9:4555801-4555823 CAGTTACTGTGGGCTTTCAGAGG - Intronic
1058168418 9:101648834-101648856 CAGTTTTTGTGGGTGTTGTTTGG + Intronic
1059780218 9:117518288-117518310 CAGTGTGTGTGGGCGGGGTGGGG - Intergenic
1186107672 X:6225595-6225617 CAGTTTGTGTGGGCGTTCTGCGG - Intronic
1186429486 X:9492626-9492648 CAGCTGGTGTGAGCGTTTTGTGG + Intronic
1189334951 X:40165382-40165404 CAGTTGGTGCTGGCTTTCTGTGG - Intronic
1190649720 X:52557028-52557050 CTGTTTGTGTGGGTGTTGAGGGG + Intergenic
1191756337 X:64596591-64596613 CAGTTTGTGTGGGACTTAGGGGG + Intergenic
1193578398 X:83231836-83231858 AAGTTTTTGTGGGGGTTGTGGGG + Intergenic
1196662771 X:118285025-118285047 CAGTTTGTGTTTGAGTTCTGGGG - Intergenic
1197870607 X:131059286-131059308 CAGTGTGGGTGGGGGTCCTGGGG - Intronic
1201078247 Y:10203656-10203678 CTGTTTGTGTGTGCATTCTTTGG + Intergenic
1201328724 Y:12795933-12795955 CATTTTGTGTGGACTTCCTGTGG + Intronic
1201489680 Y:14525936-14525958 CAGTTTGTGTGGTCGTTCTGCGG + Intronic