ID: 1186107929

View in Genome Browser
Species Human (GRCh38)
Location X:6226772-6226794
Sequence AGCCGCGGAGTGGAGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186107918_1186107929 10 Left 1186107918 X:6226739-6226761 CCGGCCTCTTGGAAAACCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 165
Right 1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 247
1186107916_1186107929 22 Left 1186107916 X:6226727-6226749 CCGGGGTAGCGACCGGCCTCTTG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 247
1186107924_1186107929 -6 Left 1186107924 X:6226755-6226777 CCAGAGGCGGAGGGAGCAGCCGC 0: 1
1: 0
2: 1
3: 26
4: 299
Right 1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 247
1186107915_1186107929 25 Left 1186107915 X:6226724-6226746 CCTCCGGGGTAGCGACCGGCCTC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 247
1186107921_1186107929 6 Left 1186107921 X:6226743-6226765 CCTCTTGGAAAACCAGAGGCGGA 0: 1
1: 0
2: 0
3: 15
4: 113
Right 1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186107929 Original CRISPR AGCCGCGGAGTGGAGGGCGC AGG Intronic
900227662 1:1540503-1540525 AGGCGCGGGGGGGGGGGCGCCGG + Intergenic
900326451 1:2110756-2110778 AGCAGCGGAGTGAAGGGGGCTGG + Intronic
900348656 1:2224470-2224492 AGGCGCGGAGTGGCTGGGGCTGG - Intergenic
901054053 1:6440491-6440513 GGGCGGGGAGTGGAGGGAGCGGG + Intronic
901279878 1:8026029-8026051 GGCGGGGGCGTGGAGGGCGCGGG - Intronic
901663577 1:10814006-10814028 ACCCGTGGCGGGGAGGGCGCTGG - Intergenic
902480240 1:16707819-16707841 GGGCGGGGAGTGGAGGGAGCGGG - Intergenic
902637344 1:17743300-17743322 AGGCGGGGAGGGGAGGGGGCCGG + Intergenic
903473808 1:23605873-23605895 AGTCGCTGAGTGGAGGGGCCAGG - Intronic
903897838 1:26620540-26620562 ATCCGCGGAGAGAAGGGCGGGGG + Intergenic
905137104 1:35808279-35808301 CGCCGCGGAGACGCGGGCGCTGG - Exonic
905369281 1:37474633-37474655 AGGCGCGGCGGGGAGGGTGCGGG + Intronic
909488624 1:76201735-76201757 AGCCGGGGAGTGGAAATCGCAGG + Intronic
910388028 1:86705278-86705300 AGCCCCGGGGTGGAGGCCACAGG - Intronic
915458004 1:156053483-156053505 GGCCCCGGAGAGGAGGGCGGGGG - Intronic
916856152 1:168752555-168752577 AGCCCTGGAGTTGAGGGCGGGGG - Intergenic
922615988 1:226961504-226961526 AGCCGTGGACTGCAGGGCCCTGG - Exonic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
924940892 1:248811954-248811976 GAACGCGGAGTGGAGGGCGCCGG - Exonic
1063463572 10:6229392-6229414 AGCCGCAGAGAGGAGGCGGCCGG - Intronic
1063785576 10:9379501-9379523 TGGCGCGGAGTGGGGGGCGGGGG - Intergenic
1064208942 10:13347725-13347747 AGGAGCGGAGGGGAGGGCGGCGG - Intronic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1069521363 10:69124193-69124215 AGCGCCGGAGCGGAGGGAGCCGG + Exonic
1069963003 10:72089297-72089319 AGCCGGGGAGTGGGGGGCTGGGG + Intergenic
1070328232 10:75401440-75401462 AGCAGCGGGGGGGAGGGCTCCGG + Exonic
1070675642 10:78409682-78409704 AGTCAGGGAGTGGAGGGGGCAGG - Intergenic
1072021876 10:91410460-91410482 ACCAGCGGAGTGGCGGGCGAGGG - Exonic
1076335882 10:129706185-129706207 AGACGCAGAGTGGAGGCCTCGGG - Intronic
1076729240 10:132429953-132429975 AGACGCCCAGTGGAGGGCTCAGG - Intergenic
1077081575 11:726791-726813 GGCGGGGGAGAGGAGGGCGCAGG - Intronic
1077556414 11:3228157-3228179 AGCCCCGGGGTGGGGGCCGCTGG + Exonic
1079154796 11:17935898-17935920 GGCAGCAGAGTGGAGGGAGCAGG + Intronic
1079251595 11:18791465-18791487 AGCCGGAAGGTGGAGGGCGCGGG - Intronic
1080406899 11:31987569-31987591 AGCCCCGGGGTGGCGGGCGCGGG + Intronic
1081715323 11:45246026-45246048 AGCCGTGGAGTGAAGGGCCTGGG - Intronic
1081899635 11:46617113-46617135 AGCCGCGGAGAGGTGGGTGACGG - Exonic
1083234735 11:61344140-61344162 AGCCTCGAAGCGGATGGCGCTGG + Exonic
1083309064 11:61775327-61775349 AGCCACAGGGTGGAGGGCGGGGG - Intronic
1083312750 11:61793093-61793115 AGCCGGGGTCTGGAGTGCGCGGG + Intronic
1083639939 11:64140085-64140107 AGGGGTGGGGTGGAGGGCGCTGG - Intronic
1083773822 11:64883458-64883480 TGCCGCTGAGTGCAGGGTGCAGG + Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084165420 11:67372992-67373014 GGCGGCGGAGAGGAGGGCGGAGG - Intronic
1084360309 11:68664797-68664819 AGCCCTGGAGTGGAGGGAGCTGG + Intergenic
1084762923 11:71285305-71285327 AGGCGGGGAGTGGAGGGCGGGGG - Intergenic
1086424689 11:86672092-86672114 AGCCGAGGAGTGGCGGGGGCTGG - Intronic
1089589512 11:119531464-119531486 AGCCTGGGAGTGGAGGTGGCCGG - Intergenic
1090972449 11:131655033-131655055 ACCGGCGGAGTGGCGGGGGCGGG - Intronic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1091636159 12:2198377-2198399 AGCCGCAGAGGGGAGGCCTCCGG - Intronic
1102002592 12:109566630-109566652 AGCTGCAGAGTGCAGGGAGCAGG - Intronic
1105015379 12:132783498-132783520 GGCTGGGGAGTGGGGGGCGCCGG + Intronic
1105413869 13:20192899-20192921 AGTCGGGGAGAGGAGCGCGCGGG + Intergenic
1108063182 13:46553102-46553124 AGCAGCCGGGGGGAGGGCGCAGG + Intergenic
1118321975 14:64758537-64758559 TGCTGCTGAGTGGAGGGCTCTGG + Intronic
1118797149 14:69153430-69153452 CTCCGCGGAGTGCGGGGCGCTGG - Intergenic
1118854615 14:69611543-69611565 CCCCGCGGAGGGGAGGGGGCGGG - Intergenic
1122082395 14:99274636-99274658 TGCCGCGAGGTGGAGCGCGCCGG - Intergenic
1122880898 14:104689990-104690012 GGCCGCAGAGTGGTGGGCCCAGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1202940095 14_KI270725v1_random:137555-137577 AGCCGCGGCGTTGGGGGCGGGGG + Intergenic
1124490254 15:30151034-30151056 GGCCAGGGAGGGGAGGGCGCAGG + Intergenic
1124712983 15:32030548-32030570 AGCCGAGACGTGGAGCGCGCCGG + Exonic
1124753279 15:32387295-32387317 GGCCAGGGAGGGGAGGGCGCAGG - Intergenic
1124975019 15:34522995-34523017 GGCCAGGGAGGGGAGGGCGCAGG - Intergenic
1127606497 15:60592421-60592443 AGCCGCGGTGCGGAGAGCGCAGG + Intronic
1129210451 15:74065042-74065064 GGCCGGGGAGGGGAGGACGCAGG - Intergenic
1129457745 15:75684666-75684688 AGCCGCGAAGTAGGGGACGCTGG + Intronic
1129644615 15:77419467-77419489 AGCCGCGGCGCGAAGGGAGCAGG + Intronic
1129840240 15:78739296-78739318 GGCCGGGGAGGGGAGCGCGCAGG + Intergenic
1130258663 15:82337699-82337721 GGCCGGGGAGGGGAGGGCGTAGG - Intergenic
1130270022 15:82441385-82441407 GGCCGGGGAGGGGAGGGCGTAGG + Intergenic
1130462355 15:84168698-84168720 GGCCGGGGAGGGGAGGGCGTAGG + Intergenic
1130481388 15:84361688-84361710 GGCCGGGGAGGGGAGGGCGTAGG + Intergenic
1130485432 15:84395907-84395929 AGCCGGGGAGGGGAGGGCGTAGG + Intergenic
1130490317 15:84426087-84426109 GGCCGGGGAGGGGAGGGCGTAGG - Intergenic
1130501909 15:84504845-84504867 GGCCGGGGAGGGGAGGGCGTAGG - Intergenic
1130596256 15:85252261-85252283 GGCCGGGGAGGGGAGGGCGTAGG + Intergenic
1131111335 15:89766946-89766968 AGCCGCAGGGTGCAGGGCACAGG + Intronic
1132408508 15:101559818-101559840 AGCAGGGGAGTGGAGGGTGGAGG - Intergenic
1133277874 16:4648931-4648953 AGCCCCGGAGAGGAGGACCCGGG - Intronic
1133295350 16:4749174-4749196 GGCCCCGGAGTGGAGGGGGCAGG - Exonic
1135655539 16:24245390-24245412 AGCCACAGAGTGGATGGCACAGG - Intergenic
1138086858 16:54141332-54141354 AGCTGGGGAGTGGTGGGCCCAGG - Intergenic
1138374746 16:56555112-56555134 AGCTGGGGAGTGGAGGGAGGTGG - Intergenic
1140903044 16:79387556-79387578 AGCCTCAGAGTGGAGTGCACTGG - Intergenic
1141283891 16:82653542-82653564 AGACATGGAGTGGAGGGAGCTGG + Intronic
1141605634 16:85151905-85151927 AGCCGGGGAGAGGAGGGCGGGGG - Intergenic
1141646869 16:85372145-85372167 AGCCAGGGAGTGGAGGGTCCGGG - Intergenic
1141764053 16:86047062-86047084 AGCCGCTGAGGGGTGGGCGGTGG + Intergenic
1142155468 16:88530974-88530996 GGCCGCAGAGGGGAGGGCGCGGG + Intronic
1142206240 16:88784579-88784601 CGCTGCGGAGAGGAGGCCGCCGG - Intronic
1142697228 17:1640250-1640272 AGCCTCAGAGGGGAGGGAGCTGG + Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1144568704 17:16381272-16381294 GGCCGCTGAGGGGAGGGCGTGGG + Intronic
1144816511 17:18039247-18039269 AGGCGCGGCGTGGAGGGGGCGGG - Intergenic
1144956989 17:19023640-19023662 AGCCGCGGGGTGGGGGGTGGGGG - Intronic
1145041373 17:19580158-19580180 CGCCGCGCAGGGGTGGGCGCGGG + Intergenic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146197373 17:30824827-30824849 AGCCGCGGGGCGGGCGGCGCTGG - Intergenic
1146257331 17:31399078-31399100 AGCCCTGGAGTGTAGGGCGGAGG + Intronic
1147317334 17:39627231-39627253 GCCCGCCGAGGGGAGGGCGCGGG - Exonic
1147726094 17:42567026-42567048 GGTCGCGGATTGGCGGGCGCGGG + Intergenic
1148130143 17:45257386-45257408 AGACGGAGAGTGGAGGGAGCAGG - Intronic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148211809 17:45813254-45813276 AGCCGCGGAGTGGAGTTAGAAGG - Intronic
1148643815 17:49207490-49207512 AGTCGAGGTGTGGAGGGAGCTGG - Intronic
1148689176 17:49516939-49516961 AGCTGCAGAGTGGAGGGTGCTGG + Intergenic
1150292648 17:63990539-63990561 AGCCCCAGAGTGGAGGGAGGAGG - Intergenic
1151558646 17:74859712-74859734 TGCTGCGGAGGGGAGGGGGCGGG - Intronic
1151589728 17:75035246-75035268 AGCCGCGGTGTGGAGGGATTGGG - Intronic
1151995685 17:77607565-77607587 AGCCGCGGAGAGGTGAGCTCAGG + Intergenic
1152174964 17:78781762-78781784 GGCCGAGGGGTGGAGGTCGCTGG - Intronic
1152362635 17:79839615-79839637 GGACGCGGAGGGGAGGGCGCCGG + Intergenic
1152551557 17:81032912-81032934 AGCCGCCGGGCGGAGGGAGCAGG + Intergenic
1152575646 17:81139713-81139735 AGCAGCGCAGTGGAGGGCTGGGG - Intronic
1152793244 17:82293268-82293290 GGCAGGGGAGTGGAGGGCGCGGG + Intergenic
1152842366 17:82578287-82578309 AGCCCCGGAAGGGAGGGAGCTGG + Intronic
1156473957 18:37394234-37394256 AGGGGCGGGGCGGAGGGCGCGGG + Intronic
1157618558 18:49002177-49002199 AGCCTCGGAGGGGAGCGGGCAGG + Intergenic
1159040603 18:63320109-63320131 CGGCGCGGAGGGGCGGGCGCGGG + Exonic
1160531590 18:79568139-79568161 AGCGGAGAAGTGGAGGGAGCTGG - Intergenic
1160538399 18:79607428-79607450 AGGCCCAGAGAGGAGGGCGCTGG + Intergenic
1160696845 19:489056-489078 TGCCGCGGAGCGCGGGGCGCCGG - Intergenic
1160726156 19:618687-618709 AGCCGGTGAGTGGGGGGCCCGGG - Exonic
1160766029 19:808468-808490 GGCCCCGGGGTGGAGGGGGCAGG + Intronic
1161304086 19:3557416-3557438 AGCCCGGGGGTGGGGGGCGCGGG - Exonic
1162141000 19:8585551-8585573 TGCCGCGGAGGAGAAGGCGCTGG - Exonic
1162381297 19:10333411-10333433 TGCCGCGGAGCGCCGGGCGCCGG - Exonic
1162550204 19:11354599-11354621 AGGAGGGGAGTGGAGGGCTCAGG - Exonic
1162773629 19:12965555-12965577 CTCCGTGGAGGGGAGGGCGCGGG + Intronic
1163156546 19:15442793-15442815 AGCTGGGGTGTGGAGGGCCCCGG - Intronic
1163424841 19:17235632-17235654 AGGCGCGGCGTGGAGGCCGGCGG + Exonic
1163747217 19:19055681-19055703 ACCCACGGAGGGGAGGCCGCAGG + Intronic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1164833910 19:31344720-31344742 ATCCCAGGAGTGGAGGGCGGCGG + Intronic
1167517416 19:49931050-49931072 AGCTGGGGAGTGGAGGGCAGGGG + Intronic
1168056801 19:53868879-53868901 AGCCGCGGAGGGGGGCGCGCAGG - Intronic
1168405513 19:56108335-56108357 AGGGGCGGGGTGGAGGGAGCCGG - Intronic
1202714279 1_KI270714v1_random:33729-33751 GGGCGGGGAGTGGAGGGAGCGGG - Intergenic
925229376 2:2219255-2219277 AGCCGCTTAGTGTAGGGCCCAGG + Intronic
926101885 2:10123053-10123075 AGCCGGTGAGTGGCGGGCGTGGG + Exonic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
928359498 2:30651580-30651602 AGCTGTGGAGTTGAGGGAGCTGG - Intergenic
929501427 2:42494111-42494133 AGCCGGGGAGGTGCGGGCGCGGG - Intergenic
931232403 2:60385911-60385933 AGTTGCAGAGTGGAGGGGGCAGG + Intergenic
932699814 2:73984976-73984998 GGCCGAGGAGGGGACGGCGCAGG - Intergenic
934519896 2:95013520-95013542 AGCCTGGGAGAGGAGGACGCAGG - Intergenic
935692865 2:105745588-105745610 AGCCGCGGATCGCAGGGCCCCGG + Intronic
935866460 2:107392545-107392567 AGCCGCGGGGTGGGGGACTCAGG - Intergenic
936935694 2:117836549-117836571 AGCCGCAGACGGGAGGGCGATGG + Intergenic
937109305 2:119350593-119350615 AGCTGCAGAGGGGAGGGTGCTGG - Intronic
937408114 2:121649290-121649312 TCCCGCGCAGTGGCGGGCGCCGG - Intronic
938296219 2:130181373-130181395 GGCTGGGGAGTGGAGGGCCCCGG - Intronic
938426901 2:131200610-131200632 AGCCCCTGAGTGCAGGGCACAGG - Intronic
938460529 2:131493274-131493296 GGCTGGGGAGTGGAGGGCCCCGG + Intergenic
941600421 2:167536757-167536779 AGCAGCAGAGTGGAGGGGCCTGG - Intergenic
942302029 2:174571906-174571928 GGCCGCGGAGTGGAAGGCACTGG + Exonic
942678231 2:178450841-178450863 AGCCGCGGAGGCGTGGGCGCCGG + Intronic
942811650 2:180007012-180007034 AGACGCGGAGTGGGGGTGGCGGG - Exonic
944553223 2:200864423-200864445 AGCCTGGGAGTGAAGGGAGCAGG + Exonic
945033709 2:205686571-205686593 AGCGGCTGGGTGGCGGGCGCCGG + Intronic
946392833 2:219426670-219426692 AGCAGGGGAGGGGAGGGCGTGGG - Exonic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1169278451 20:4248779-4248801 GGCGGCGGCGTGGTGGGCGCAGG - Exonic
1170429222 20:16261410-16261432 AGCTGCAGAGTGGTGGGGGCAGG - Intergenic
1170562769 20:17570571-17570593 GGCCGGGGAGTGGGGGGCGGGGG + Intronic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172887437 20:38240719-38240741 AGCCCAGGAGTGGGGGGCTCAGG + Exonic
1174804486 20:53593850-53593872 GGGCGCGGAGGGGAGGGGGCGGG + Intronic
1175965135 20:62656576-62656598 GGCAGCGGAGCGGAGGGAGCCGG - Exonic
1176286310 21:5021130-5021152 GCCCGCGGAGTGCAGGGCGGAGG - Intergenic
1176377835 21:6095571-6095593 CCACGCGGAGTGGAGGGGGCAGG + Intergenic
1176583083 21:8549516-8549538 AGCCGCGGCGTCGGGGGCGGGGG - Intergenic
1179491032 21:41741740-41741762 GGCCGTGGAGAGGAGGGTGCGGG - Exonic
1179745639 21:43442677-43442699 CCACGCGGAGTGGAGGGGGCAGG - Intergenic
1179870871 21:44242345-44242367 GCCCGCGGAGTGCAGGGCGGAGG + Intergenic
1180102389 21:45594931-45594953 AGCAGTGGAGTGGAGGGAGGTGG - Intergenic
1180560389 22:16610252-16610274 GGGCGCGGAGGGGAGGGGGCGGG + Intergenic
1182104469 22:27679539-27679561 AGCCACGGAGTGGAGGCCCCGGG + Intergenic
1183535511 22:38398532-38398554 GGGCGCGGAGGGGAGGGGGCGGG + Intergenic
1183679587 22:39319845-39319867 AGCCGCGGAGAGGTGGGCTAAGG + Intronic
1184871418 22:47241176-47241198 TGTCGCGGGGTGGAGGGAGCGGG - Intergenic
950729850 3:14947824-14947846 CGGCGCGGAGGGCAGGGCGCGGG - Intronic
951363435 3:21751346-21751368 AGGGGCGGAGTGAGGGGCGCGGG + Exonic
952311250 3:32192466-32192488 AGCCTGGGAGTGGAGAGGGCTGG - Intergenic
952316702 3:32238489-32238511 CGGCGCGGAGGAGAGGGCGCAGG - Intergenic
953055338 3:39383466-39383488 AGCCGCGGAGTCTGCGGCGCGGG + Exonic
959049685 3:101512980-101513002 AGCCGCGGGGGCGAGGGCGGGGG - Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
966762291 3:183428712-183428734 AGCCGCGGAGAGAAGGGGGCTGG + Intronic
968541912 4:1172237-1172259 ATCAGCGGAATGGACGGCGCGGG + Intronic
968602854 4:1518510-1518532 GGCTGCGGAGGGGACGGCGCAGG + Intergenic
968630509 4:1648483-1648505 AGCCGCGGTCAGGAGGGCTCTGG + Intronic
969239032 4:5887740-5887762 AGGCGGGGAGTGGGGAGCGCTGG + Intronic
969410636 4:7025723-7025745 AGGCCCAGAGAGGAGGGCGCGGG + Intronic
970824191 4:20253150-20253172 TGCGGCGGAGTCGAGGGCGAGGG + Intergenic
971405666 4:26319654-26319676 AGCCGAGTAGTGGAAGGCGGTGG + Intronic
971991268 4:33898043-33898065 AGCAGGGAAGTGGAGGTCGCAGG + Intergenic
981782666 4:148444881-148444903 CGCTGCGGAGCGGCGGGCGCGGG - Intergenic
985619896 5:948719-948741 GGGCGCAGAGTGGATGGCGCAGG + Intergenic
985664812 5:1176584-1176606 AGCTGCGGGGTCGGGGGCGCAGG + Intergenic
987595147 5:19988330-19988352 AGCCGCGGAGAGGAGAGCCAGGG - Intronic
990449291 5:55919783-55919805 AGCCTCAGAGTTCAGGGCGCAGG + Intronic
996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG + Exonic
1001348282 5:170930556-170930578 TGCCGGGGAGTGGGGGGAGCGGG - Intronic
1001906542 5:175478412-175478434 AGAAGCGGAGTCGCGGGCGCGGG + Exonic
1002277522 5:178113628-178113650 AGCGGCGGAGCGGCAGGCGCCGG - Exonic
1002455965 5:179345463-179345485 AGGCGCGGAGGGGCGGGCGGGGG + Intergenic
1002524342 5:179806968-179806990 CGCCGCGGAGTCGACGGCGCAGG + Intronic
1002784712 6:392390-392412 AGCGGAGGCGGGGAGGGCGCGGG - Intronic
1002927180 6:1611328-1611350 GGCGGCGGGGCGGAGGGCGCGGG - Exonic
1006153741 6:32002930-32002952 AGCCGGGCAGTGGAGGGCCTTGG - Intergenic
1006160049 6:32035667-32035689 AGCCGGGCAGTGGAGGGCCTTGG - Intergenic
1006474254 6:34244737-34244759 AGCCAGGGAGTGCAGGGAGCGGG + Intronic
1006611253 6:35295790-35295812 AGCTGAGGAGTGGTGGGGGCTGG - Exonic
1007431728 6:41780656-41780678 AGCCGGGGAGGGGCGGGCGGGGG + Intronic
1007901282 6:45415516-45415538 AGCCCAGGAGGGGAGGGTGCTGG + Intronic
1010033030 6:71289292-71289314 AGCCGCGGCGCGGAGGGGTCGGG - Intronic
1011696521 6:89918099-89918121 AGCCCCAGTGTGGAGGGGGCTGG + Intergenic
1012237772 6:96837863-96837885 AGGCGCGGGGTGCAGGGCGCAGG - Intergenic
1013099081 6:106973354-106973376 GGGCGGGGAGTGGAGGGGGCCGG + Intronic
1015935646 6:138404229-138404251 CGCCGCGGAGGGGCGGGGGCAGG + Exonic
1017146699 6:151240992-151241014 AGCCGCCGTGGGCAGGGCGCGGG - Intronic
1017709963 6:157158645-157158667 AGAAGCAGAGTGGAGGGAGCAGG - Intronic
1017834882 6:158168224-158168246 AGCCGCCGGGTGGAGGGTCCCGG - Exonic
1018941036 6:168308908-168308930 AGCCACGGCGTGCAGGGGGCTGG + Exonic
1019029008 6:168994549-168994571 AGCAGGGGAGTGGGGGGCGCAGG + Intergenic
1019301428 7:306017-306039 AGGCCCGGGCTGGAGGGCGCAGG - Intergenic
1019642366 7:2110896-2110918 AGCCGAGGAGATGACGGCGCGGG + Intronic
1020011242 7:4807049-4807071 AGCAGAGGGGTGGAGGGCGCGGG - Intronic
1020105999 7:5422619-5422641 GGGCGCGGAGTGCAGGGCGCCGG - Intronic
1022139039 7:27476217-27476239 AGCAGAGGAGTGGGCGGCGCAGG - Intergenic
1022381825 7:29867546-29867568 AGCTGGGGTGTGGAGGGGGCGGG - Intronic
1024260201 7:47568621-47568643 CACCGCAGAGTGGAGGCCGCAGG - Intronic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1027121897 7:75527903-75527925 AGCCCCGGAGTCGGCGGCGCTGG - Intergenic
1030201673 7:106911949-106911971 AGGTGCAGAGTGGAGGGTGCTGG - Intergenic
1032085097 7:128879687-128879709 AGCCGAGGAGTGGAGGAAGGTGG - Intronic
1033253241 7:139777935-139777957 ATCCGCGGAGGGGCGGGAGCCGG + Intronic
1034147441 7:148884870-148884892 GCCCGGGGAGGGGAGGGCGCGGG + Intergenic
1034218047 7:149422838-149422860 AGGCGCCAAATGGAGGGCGCAGG + Intergenic
1034383170 7:150716700-150716722 AGCCTGGGAGTGGCGGGGGCTGG + Intronic
1035424334 7:158757645-158757667 AGCCGCGGGGTGCCTGGCGCGGG - Intronic
1040569318 8:48593692-48593714 AGCCTTGGAGCGGAGGGTGCTGG + Intergenic
1052804940 9:33004707-33004729 AGCCGCGAGGTGGAGGTTGCAGG - Intronic
1053550986 9:39078955-39078977 AGCGGCGGAGATGGGGGCGCAGG + Intronic
1053815095 9:41899034-41899056 AGCGGCGGAGATGGGGGCGCAGG + Intronic
1054615501 9:67288407-67288429 AGCGGCGGAGATGGGGGCGCAGG - Intergenic
1056855727 9:90128120-90128142 ACCCGGGGAGCGGAGGGCACAGG - Intergenic
1057234283 9:93346360-93346382 AGCCACGGAGGGGAGGCGGCCGG + Exonic
1058973137 9:110101294-110101316 AGGAGTGGAGTGGAGGGTGCAGG - Intronic
1059268947 9:113060613-113060635 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059270083 9:113066062-113066084 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059271217 9:113071510-113071532 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059272350 9:113076956-113076978 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059273485 9:113082398-113082420 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1059274621 9:113087844-113087866 AGCCGCGGAGGGGTGGGGGATGG - Intergenic
1060477902 9:123999550-123999572 AGCCACGGAGCGGGGGGCGGGGG + Intergenic
1060528213 9:124332424-124332446 AGCCAGGGAGTGGAGGAAGCAGG + Intronic
1061245509 9:129399454-129399476 GGCTGCGGAGTGGAGGGACCAGG - Intergenic
1061472047 9:130834998-130835020 AGCCCCGGCGGGGAGGGTGCAGG - Intronic
1061577914 9:131519096-131519118 AGCAGCTGAGTGCAGGGTGCAGG - Intronic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1203613064 Un_KI270749v1:27381-27403 AGCCGCGGCGTCGGGGGCGGGGG - Intergenic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1189325684 X:40109491-40109513 GGCCGAGGAGCGGAGGTCGCCGG - Intronic
1196888715 X:120272076-120272098 AGCAGGGGAGTGGAGGGTGTGGG + Intronic
1197734356 X:129839806-129839828 AGCAGAGGAGTGGAGGGGGGAGG - Intronic
1197775174 X:130114223-130114245 AGCCGTGGGCTGCAGGGCGCTGG - Intergenic
1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG + Intergenic
1200086652 X:153610375-153610397 AGACACGGCGTGGAGGGTGCGGG - Intergenic
1200126686 X:153818645-153818667 AGCCCGGGAGGGGAGGGCGAAGG + Intronic
1200128683 X:153829983-153830005 AGGCGCGGTGCGGCGGGCGCGGG - Intronic
1200284304 X:154805576-154805598 AGCCGCGGAGTCCGGGGCGTGGG - Intronic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic