ID: 1186107968

View in Genome Browser
Species Human (GRCh38)
Location X:6226915-6226937
Sequence GCGGGTGCCAGCGCGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 347}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186107958_1186107968 7 Left 1186107958 X:6226885-6226907 CCCCGCTCGCGCTTCCGCAGGTC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107954_1186107968 18 Left 1186107954 X:6226874-6226896 CCCTACCTCATCCCCGCTCGCGC 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107964_1186107968 -7 Left 1186107964 X:6226899-6226921 CCGCAGGTCAGGCCACGCGGGTG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107955_1186107968 17 Left 1186107955 X:6226875-6226897 CCTACCTCATCCCCGCTCGCGCT 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107959_1186107968 6 Left 1186107959 X:6226886-6226908 CCCGCTCGCGCTTCCGCAGGTCA 0: 1
1: 1
2: 0
3: 5
4: 60
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107960_1186107968 5 Left 1186107960 X:6226887-6226909 CCGCTCGCGCTTCCGCAGGTCAG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107952_1186107968 24 Left 1186107952 X:6226868-6226890 CCCTCTCCCTACCTCATCCCCGC 0: 1
1: 0
2: 5
3: 62
4: 821
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107956_1186107968 13 Left 1186107956 X:6226879-6226901 CCTCATCCCCGCTCGCGCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107953_1186107968 23 Left 1186107953 X:6226869-6226891 CCTCTCCCTACCTCATCCCCGCT 0: 1
1: 0
2: 2
3: 59
4: 697
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347
1186107951_1186107968 27 Left 1186107951 X:6226865-6226887 CCTCCCTCTCCCTACCTCATCCC 0: 1
1: 0
2: 18
3: 204
4: 2065
Right 1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG 0: 1
1: 0
2: 4
3: 27
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186107968 Original CRISPR GCGGGTGCCAGCGCGGGCTG TGG Intronic
900191613 1:1354572-1354594 GCGGATCCCAGCGGGGGCCGTGG - Intronic
900668660 1:3834894-3834916 GCTGGAGCCAGCGCCAGCTGAGG + Intronic
901068125 1:6504293-6504315 GCGGGAGGCAGCACGGGATGTGG - Intronic
901791387 1:11655110-11655132 GCGGCTGCGAACGGGGGCTGGGG + Intronic
902089583 1:13892864-13892886 CGGGGTGGCGGCGCGGGCTGGGG + Intergenic
902627188 1:17683470-17683492 ACGGGTCCCAGAGGGGGCTGAGG - Intronic
904618879 1:31763906-31763928 GCGGGGGCCGGCGCTGGCGGGGG + Exonic
905360803 1:37418961-37418983 GGGGGTGACTGCGGGGGCTGGGG - Intergenic
906196568 1:43933842-43933864 CCGGGTGGCAGCGAGGGCTGGGG - Exonic
907221682 1:52911690-52911712 GCGGGCGCCAGGGTGGGCTGGGG - Intronic
909203685 1:72725772-72725794 CAGGGTGCTAGCGGGGGCTGGGG - Intergenic
912385679 1:109270184-109270206 GGGGTTGCCAGTGGGGGCTGGGG - Intronic
912915615 1:113811952-113811974 GCGGGTGCCAGCGAAGGTGGCGG + Exonic
914490908 1:148149613-148149635 GTGGGGGCCGGCGCGGGGTGAGG - Intronic
917817374 1:178725004-178725026 GCGGATGGCTGCGCGCGCTGCGG + Intergenic
920002060 1:202807435-202807457 GGGGCGGCCAGCGCTGGCTGGGG - Intronic
920920311 1:210292714-210292736 GCGGGTGGCAGCGCAGGCGTGGG - Intergenic
922424572 1:225481040-225481062 GAGGGAGCCAGCAGGGGCTGTGG - Intergenic
1062902280 10:1155579-1155601 GTGGGTGTCAGTGCAGGCTGGGG + Intergenic
1064167883 10:13001831-13001853 GCGGGTCCCGGCGCCGGCTGGGG + Intronic
1064369866 10:14741834-14741856 GCGGGTGCCTGTGGAGGCTGAGG - Intronic
1065099100 10:22316304-22316326 GCTGGCGGCGGCGCGGGCTGCGG - Exonic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1067047539 10:42992965-42992987 GGGGGTGCTGGCGCAGGCTGAGG - Intergenic
1067769904 10:49115555-49115577 GCGGGCGCGAGCGCGGGCCCGGG - Intergenic
1070368459 10:75758440-75758462 ACGGGTCCCAGCCGGGGCTGAGG - Intronic
1070610022 10:77926648-77926670 GCCGGGGCCTGGGCGGGCTGGGG + Intergenic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1073380295 10:103073080-103073102 ACGGGCGCCAGCGCGAGCAGAGG - Intronic
1074502983 10:114043509-114043531 GCGGGAGCGAGTGGGGGCTGAGG + Intergenic
1076149284 10:128149884-128149906 GCGGGCGGGAACGCGGGCTGTGG - Intergenic
1076166546 10:128286843-128286865 GTGGGCGCCAGTGCAGGCTGGGG - Intergenic
1076209266 10:128627442-128627464 GCGTGAGCCACCGCGGGTTGTGG - Intergenic
1076883851 10:133252424-133252446 GCGGGGTGCAGGGCGGGCTGGGG - Intergenic
1077096211 11:800193-800215 GCGGGTGCCCGAGGAGGCTGAGG - Exonic
1077370373 11:2179108-2179130 TGGGGGGCCAGGGCGGGCTGTGG - Intergenic
1077387313 11:2276149-2276171 GGGGGTGCCAGTGTGGGCCGCGG + Intergenic
1079394637 11:20051083-20051105 GCTGGTGTCAGCTCAGGCTGAGG + Intronic
1080779677 11:35419078-35419100 GCGGGTGGAAGGGCGGGCAGAGG - Exonic
1081994580 11:47355202-47355224 GCGGGGCCCGGCGGGGGCTGCGG + Exonic
1083562121 11:63681411-63681433 GCGGGTGCCAAAGCGCGCAGCGG - Intergenic
1084000914 11:66295074-66295096 GCGCGTACCAGGGCGGGCTGCGG - Exonic
1084112696 11:67023958-67023980 GCTGGTGCCACCGGCGGCTGAGG - Intronic
1084178629 11:67435909-67435931 GCAGGTCCCCGTGCGGGCTGAGG - Exonic
1084317500 11:68353949-68353971 GTGGGTGGCAGAGCGGGCTCTGG + Intronic
1084490613 11:69476363-69476385 GCCGGTGCCAGGGCTGGGTGGGG - Intergenic
1086376134 11:86202728-86202750 GCGGGCGCCTGCGGAGGCTGAGG - Intergenic
1089129225 11:116199180-116199202 GGAGGTACCAGCGCAGGCTGCGG + Intergenic
1089169277 11:116500853-116500875 GCGGGTGCACGCGGGGGCCGGGG - Intergenic
1089273363 11:117316132-117316154 GCGGGCGGCGGCGCGGGCAGGGG + Exonic
1089537410 11:119169098-119169120 GCGGGGGGCAGGGCGGGCCGGGG + Exonic
1089609641 11:119662348-119662370 GCAGCTGCCAGCCTGGGCTGAGG - Exonic
1090351586 11:126111592-126111614 GTGGGTGCCAGCCCTGCCTGGGG + Intergenic
1092184840 12:6471037-6471059 GCGAGTCCCGGCGCGGGGTGGGG - Intergenic
1092204389 12:6606671-6606693 GCTGGTGCAAGCGCGGGGAGGGG + Intronic
1093247814 12:16761903-16761925 GAGGGTGCCAGCTGGGGGTGGGG - Intergenic
1095049588 12:37544137-37544159 TCGGGTGACAGAGCGGCCTGAGG - Intergenic
1096461072 12:51821674-51821696 GGCGGTGCCGGCGCGGGCAGGGG + Intergenic
1096968334 12:55646511-55646533 GCGTGGGCCAGCGCAGGCAGAGG + Intergenic
1097848669 12:64390624-64390646 GCGGGTTCCAGCGCGGGGGCGGG - Exonic
1098279172 12:68845946-68845968 GCGGGTGGCAGCGGGGTCGGGGG - Exonic
1098595843 12:72272602-72272624 GGGGGTGCCAGAGGGGGCGGGGG + Intronic
1099720391 12:86354950-86354972 GGGGGTGCCACTGCTGGCTGGGG + Intronic
1100869426 12:98894934-98894956 GCGGGTGCGAGGGCGCGCGGCGG - Intronic
1101963611 12:109267446-109267468 GAGGGTGCATGCGCAGGCTGGGG - Exonic
1101970748 12:109310153-109310175 GCGGGGCCCAGAGCGGGCAGAGG + Intergenic
1102485502 12:113252637-113252659 GCCGGTGCCAGCCCCTGCTGGGG + Intronic
1105673047 13:22642144-22642166 TCTGGTGCCAGCGAGGGGTGGGG - Intergenic
1105739424 13:23307514-23307536 GATGGTGCCAGCACTGGCTGTGG + Intronic
1105890721 13:24680716-24680738 GCTGGTGGCGCCGCGGGCTGCGG - Exonic
1105975505 13:25468897-25468919 GAGGCTGCGAGCGCGGGCCGCGG - Intronic
1106087701 13:26557960-26557982 GCGGGGCCCACTGCGGGCTGCGG + Intronic
1107467548 13:40664828-40664850 GCGGGGGCGGGCGCGGGCGGTGG - Intronic
1110596483 13:77326401-77326423 GCGGGTGCACGCGCGGCATGGGG + Intronic
1113737641 13:112689913-112689935 GCGGGTGCGAGCGCGGGTGTGGG + Intergenic
1113808231 13:113122260-113122282 GCAGGTGCCAGCCTGGCCTGTGG + Intergenic
1113956308 13:114101446-114101468 GCGGGGCCCAGCACGGGCAGTGG - Intronic
1114461385 14:22888150-22888172 GCAGGTGACAGCTGGGGCTGTGG - Intergenic
1114492258 14:23110564-23110586 GTGGGTTCAAGCGCGTGCTGAGG - Intergenic
1115174567 14:30547609-30547631 GCGGGTGGCAGGGGGGGCTTAGG + Intergenic
1118845926 14:69547871-69547893 GCGTGTCCCAGCGTGGGATGCGG - Intergenic
1119738751 14:77000277-77000299 GTGGGGGCCAGCTGGGGCTGGGG + Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121074967 14:91060379-91060401 GCGGGGACCAGCGCGGACGGCGG - Exonic
1121645872 14:95516720-95516742 GCGGGTCCCGGCGGGGGCGGGGG - Intronic
1122470744 14:101964482-101964504 GCGGGTGGCTGCGGCGGCTGCGG + Intergenic
1122543329 14:102509579-102509601 GCGGGGGACAGCGCGCGCTCCGG - Exonic
1122648029 14:103207758-103207780 GCGAGCGCCTGCGCGGGCTGTGG + Intergenic
1122779255 14:104136720-104136742 GCGAGTCCCAGCCCGGGCTGCGG - Intergenic
1122808543 14:104275827-104275849 GCTGATGCCAGGCCGGGCTGTGG - Intergenic
1122939094 14:104973299-104973321 GCGGGGGCCAGGGAGGGCTGAGG + Intronic
1123425611 15:20168388-20168410 GCGGGTCCCCGGGCGGGATGGGG - Intergenic
1123534838 15:21174915-21174937 GCGGGTCCCCGGGCGGGATGGGG - Intergenic
1124182767 15:27492450-27492472 GCAGCTGCCAGCCCTGGCTGTGG + Intronic
1124427031 15:29570902-29570924 GCGGGCACCGGCGGGGGCTGCGG - Intergenic
1124441148 15:29687425-29687447 GCAGCTGCCAGTGTGGGCTGGGG + Intergenic
1124491733 15:30162119-30162141 GCAGGAGGCAGCACGGGCTGCGG + Intergenic
1124751803 15:32376190-32376212 GCAGGAGGCAGCACGGGCTGCGG - Intergenic
1125685008 15:41558933-41558955 GGCGGTGCGAGCTCGGGCTGCGG + Intronic
1126348356 15:47718826-47718848 GCGGCTGCCGGCGCGAGCGGCGG - Exonic
1127286477 15:57538028-57538050 GCAGGTGCCAGTGTGGGCTCAGG + Intronic
1127734841 15:61830888-61830910 GTGGGCACCAGCGCAGGCTGAGG + Intergenic
1128967776 15:72077644-72077666 GCGGGGGGCGGCGCGGGCAGAGG + Intronic
1129108061 15:73322704-73322726 GGGGGTGGCAGCGGGGGCAGTGG - Exonic
1129676042 15:77632819-77632841 GCGGGCGACAGCGCAGGCGGCGG - Intronic
1129676047 15:77632838-77632860 GCGGGAGCCGGAGCGGGCGGCGG - Intronic
1129743115 15:77999773-77999795 CCGGGTGCCAGCCTGGGCCGAGG - Intronic
1129842366 15:78751667-78751689 CCGGGTGCCAGCCTGGGCCGAGG + Intergenic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1129920003 15:79311642-79311664 GCAGGTGCGAGCCCGGGATGGGG + Intronic
1130656497 15:85795042-85795064 CCCGGTGCCGGCGCGGCCTGGGG - Intergenic
1132554766 16:567636-567658 CCGGGTGCCCGCAGGGGCTGTGG + Exonic
1132556118 16:573385-573407 CCGGGTGCCACCGTGGGCGGGGG + Intronic
1132639646 16:971727-971749 GCGGGTGCTAGGAAGGGCTGGGG + Intronic
1132663811 16:1072844-1072866 GGGGGTGCCCGCGCGGGAGGGGG - Intergenic
1132730949 16:1361809-1361831 GTGGGTGCGAGGGTGGGCTGGGG + Intronic
1132743821 16:1428627-1428649 GCGGGAGCCAACCCGGCCTGGGG - Intergenic
1132873233 16:2124758-2124780 GAGGCGGCCAGCGCGGGCGGGGG - Intronic
1132956782 16:2598466-2598488 GAGGGTGCCATCGAGGGCTCCGG + Exonic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1134552321 16:15143937-15143959 GAGGCGGCCAGCGCGGGCAGGGG - Intergenic
1135338979 16:21630298-21630320 GCGGGAGCCAGCGTGGGTTCCGG - Intronic
1135382977 16:22008951-22008973 CCGGGGGCGAGCCCGGGCTGCGG + Intronic
1136136960 16:28262094-28262116 GCAGGAGCCAGTGCTGGCTGGGG + Intergenic
1136365393 16:29806972-29806994 GGGGGCGCCGGCGCGGCCTGCGG - Exonic
1136517356 16:30775943-30775965 GCTGGTGGAAGCGCGGGCCGCGG + Exonic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1138383131 16:56617426-56617448 GCGGGTGCAAGCGCGGGGCGGGG + Intergenic
1138385363 16:56632579-56632601 GCGGGTGCAAGCGCGGGGCAGGG + Exonic
1138385938 16:56635665-56635687 GCGGGTGCAAGCGCGGGGCAAGG + Intergenic
1139365190 16:66428284-66428306 GCGGGTGCCGGCGTGGGTGGCGG + Intronic
1141172814 16:81701846-81701868 GGGGGGGCCAGGGCGGGATGCGG + Intronic
1142163231 16:88570288-88570310 GCGGGTCCGGGCGCGCGCTGCGG + Intergenic
1142165615 16:88585920-88585942 GCTGGTGCCCACGTGGGCTGGGG + Intronic
1142594564 17:1023212-1023234 GTGGGTGCCAGGGCAGGCAGAGG - Intronic
1142639304 17:1276403-1276425 GAGGTTGCCTGGGCGGGCTGGGG - Intergenic
1143565228 17:7716982-7717004 GAGGGTGCCAGGGGGCGCTGCGG - Intergenic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1145997681 17:29113897-29113919 GGGGGTGCCACTGTGGGCTGAGG - Intronic
1147366472 17:39962808-39962830 GCAGGTGCCAGCGTGGGTGGGGG - Intergenic
1147415712 17:40288069-40288091 GCGGGTTCCGGCGAGGCCTGAGG + Exonic
1147636316 17:41966728-41966750 GCGGGCACCCGGGCGGGCTGGGG - Exonic
1147994826 17:44354809-44354831 GCGGGGGCCCTCGGGGGCTGCGG - Exonic
1148166929 17:45490405-45490427 GGGGATGCGGGCGCGGGCTGGGG + Intronic
1148337537 17:46851645-46851667 GCCAGGGCCAGCGCGGGCGGGGG - Exonic
1148722520 17:49763977-49763999 GGGGGAGCCGGCGGGGGCTGGGG + Exonic
1148769102 17:50056682-50056704 GAGTGTGCGAGCGCGGGATGCGG + Intronic
1149614748 17:57988282-57988304 GCGGCGGCGAGCGCGGGCGGGGG + Intergenic
1150003632 17:61456578-61456600 GGCGCTGCCAGCGCGGGCTCGGG - Exonic
1150398108 17:64836809-64836831 GGGGATGCGGGCGCGGGCTGGGG + Intergenic
1151424733 17:74023598-74023620 GCTGGTTCCAGCCCAGGCTGGGG - Intergenic
1152256764 17:79244502-79244524 GGCAGTGCCAGCGAGGGCTGCGG + Intronic
1152714310 17:81891267-81891289 GAGGGGGCCAGCCGGGGCTGGGG - Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1156444565 18:37225814-37225836 GCAGGTGCCAGCCTGGGTTGGGG - Intronic
1157609980 18:48950165-48950187 GCGGGCGCCGGCGCGGCCGGGGG - Exonic
1158976527 18:62715834-62715856 GCCGGGGTCAGCGCGGGCTCCGG - Exonic
1160242128 18:77132070-77132092 CTGGCTGCCAGGGCGGGCTGGGG - Intronic
1160543308 18:79637606-79637628 GCGGCTTCCAGCGCGGGAGGAGG - Intergenic
1160730261 19:638883-638905 GTGGGTGCCACCTGGGGCTGTGG + Intergenic
1160745408 19:709032-709054 GCGGGGGCCGGGGCGGGCTAAGG - Intergenic
1160806925 19:996008-996030 GCTGGTGCCAGGGCGGGGTGAGG + Intronic
1160856987 19:1222098-1222120 GGGGGTGCCAGGCTGGGCTGGGG + Intronic
1160904320 19:1445387-1445409 GTGGGAGCCACCGCGGGCTGTGG - Intergenic
1160904517 19:1446094-1446116 GGGGGTGCTCGCGGGGGCTGGGG - Intergenic
1160994677 19:1877131-1877153 GTGGGGGCCGGCGCGGGGTGAGG + Exonic
1161072722 19:2270606-2270628 GCGGGTGCCAGCTGCGGTTGTGG + Intronic
1161075933 19:2285789-2285811 GAGGGTGCCGGCATGGGCTGGGG + Intronic
1161287986 19:3478651-3478673 GCGGGTGCAAGCCCGGGATCTGG + Intronic
1161648121 19:5466982-5467004 GCGGTTGCCAGCTGGGCCTGTGG - Intergenic
1161680210 19:5676386-5676408 GCGGAGGCCAGCTGGGGCTGGGG - Intronic
1161688949 19:5719822-5719844 GCGGGGGGCAGCGCGGGCGCCGG - Exonic
1161961863 19:7527726-7527748 GCAGGCACCAGCGCGGGCGGGGG - Intronic
1162915551 19:13872860-13872882 GCGGGTGAGAGGGCGGGCTCTGG + Intronic
1162938429 19:13993710-13993732 GTGGGTGGCTGCGGGGGCTGGGG + Exonic
1163314979 19:16535558-16535580 GCGGGGGCCAGCGGGGGCTGTGG + Exonic
1163727214 19:18929535-18929557 GCGGGAGCGGGCGCGGGCTGAGG - Exonic
1164670754 19:30070722-30070744 GCAGGTCCCAGGCCGGGCTGTGG - Intergenic
1165396532 19:35567270-35567292 CTGGGTGCCAGCCCTGGCTGTGG - Intergenic
1165803227 19:38565550-38565572 GAGGGTGCCAGCGAGGGCGCTGG + Exonic
1166067420 19:40367921-40367943 GTGGGAGGCAGCGGGGGCTGTGG + Intronic
1166827084 19:45616422-45616444 CGGGGTGGCGGCGCGGGCTGGGG + Intronic
1167507415 19:49878112-49878134 GGGGGAACCAGCGAGGGCTGGGG - Intronic
1167619900 19:50554996-50555018 GCGGGTGACTGCAGGGGCTGAGG - Intronic
1168315241 19:55482160-55482182 GCGGGTGCCTCCTGGGGCTGGGG - Exonic
1168452453 19:56477128-56477150 GCGGGTGCTTGCGTGGGCGGTGG - Intronic
925203861 2:1990500-1990522 GCGGGTGCCATGGAGGGCAGTGG + Intronic
925987745 2:9229924-9229946 GCGGTTGTCAGTGTGGGCTGGGG + Intronic
926154822 2:10448057-10448079 GCGGGAGCCGGGGCGGGCTGCGG - Intronic
927652185 2:24919715-24919737 GACGGTCCCCGCGCGGGCTGGGG + Exonic
929610705 2:43268830-43268852 GCAGGTGCCAGTGCTGGCTGGGG + Intronic
932042962 2:68319436-68319458 GCGGAGGACAGCGCCGGCTGCGG + Exonic
932182413 2:69659857-69659879 GCTGGTGGCAGTGGGGGCTGGGG + Intronic
932329448 2:70889362-70889384 GGGGGTGCGAGCGCGGGCTGGGG - Intergenic
932345829 2:70994651-70994673 GCGGGAGCCCGCGCGGGCCGGGG + Intronic
932562741 2:72887399-72887421 TCGGGTGCCAGCGCCGCCGGCGG + Exonic
932780214 2:74554640-74554662 GCGGCTGCCGGCGGGGGCCGGGG + Exonic
934541358 2:95177873-95177895 GGGAGGGCCAGCGAGGGCTGAGG + Intronic
934573965 2:95389085-95389107 ACGGGTGCCAGCGCCAGCTCTGG - Intergenic
935820164 2:106886458-106886480 GCAGCTGCAAGCGCGGGCGGCGG + Exonic
936433256 2:112482215-112482237 GCGGTAGCCGGCGCGGGCGGCGG + Exonic
937045286 2:118848021-118848043 GCGGGTGCGGGCGCGGGTGGGGG - Intergenic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
937914629 2:127092840-127092862 GGGGGTGCAGGCGTGGGCTGTGG - Intronic
937956558 2:127424945-127424967 GCTGGTGCCTGTGCAGGCTGTGG + Intronic
938407478 2:131040494-131040516 GCGGGCGCCAGCGCGGACAGCGG + Intronic
941020932 2:160407550-160407572 GCGGGTGCGGGCGCGGGCGCGGG + Intronic
942277636 2:174334728-174334750 GGGGGGGCGAGGGCGGGCTGGGG - Intergenic
942450996 2:176107932-176107954 GCGGGTGGCGGCGGGGGCTGCGG - Exonic
946185493 2:217978556-217978578 GCGGGGGCAGGGGCGGGCTGGGG - Intronic
946395454 2:219441932-219441954 GCGGGAGCCGGCGCGGGTGGCGG - Intronic
947748895 2:232522825-232522847 GCCTGCGCCATCGCGGGCTGGGG + Exonic
948552860 2:238786272-238786294 GCGGGTGCCAGGGCTGGGGGAGG - Intergenic
948645329 2:239400748-239400770 GCGGGTGGCGGCGCAGGCTGAGG - Exonic
948809597 2:240467811-240467833 GCCAGTGCCAGGGTGGGCTGGGG + Exonic
948874609 2:240820028-240820050 GTGGGTGCAGGTGCGGGCTGCGG + Intronic
949007270 2:241656740-241656762 GCTGGGGCCAGCACGGGCTCTGG - Intronic
1169195964 20:3682130-3682152 GCGGGAGCGAGGGCGGGCGGTGG - Exonic
1169278490 20:4248875-4248897 GGGGGCTCCAGCGCGGGCGGCGG - Exonic
1171121505 20:22572663-22572685 GCTGGGGCCAGGGCGTGCTGGGG + Intergenic
1171123503 20:22584104-22584126 GGGGGTGCCAGCGAGGGAAGCGG + Intronic
1171427327 20:25057316-25057338 GCGGTTGTCACTGCGGGCTGCGG - Intronic
1171494005 20:25542092-25542114 GCTGGTGCCAGAGTGGGCAGTGG + Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1173165955 20:40687696-40687718 GCGGGTGCGCGGGCGGGCAGGGG - Exonic
1173809472 20:45947439-45947461 GTGGGTGCCAGGGAGGGCAGGGG + Intronic
1173843672 20:46174867-46174889 GGGGGCGGCAGCGCGGGCGGGGG - Exonic
1175443768 20:59007176-59007198 GCGGGAGCCGGCGCGGGATCTGG - Exonic
1175999594 20:62825950-62825972 GAGGGGGCCAGCTCCGGCTGGGG + Intronic
1176055017 20:63140799-63140821 GCAGGTCACAGCCCGGGCTGTGG - Intergenic
1176302943 21:5107371-5107393 GTGGGTGCCAGTGCTGCCTGAGG - Intergenic
1178832764 21:36070277-36070299 GCTGGTGGAAGCGCGGGCTCAGG - Exonic
1178914025 21:36697221-36697243 GGAGGTGCCAGAGCGGGCTCAGG + Intergenic
1179165067 21:38929056-38929078 GCTGGTGCCAGGGTGGGTTGGGG - Intergenic
1179584560 21:42366358-42366380 GAGGCTGCCAGAGCTGGCTGTGG + Intronic
1179655521 21:42842085-42842107 GCAGGTGACCGGGCGGGCTGTGG + Intergenic
1179854082 21:44154553-44154575 GTGGGTGCCAGTGCTGCCTGAGG + Intergenic
1179909205 21:44438996-44439018 ACGGGTGCCAGGGCAGCCTGAGG + Intronic
1179985619 21:44919108-44919130 GCAGGTGACCGGGCGGGCTGTGG - Intronic
1180142575 21:45901212-45901234 GGGGTTGCCTGGGCGGGCTGGGG - Intronic
1180782701 22:18529764-18529786 GCGGGTGAGAGTGCGGACTGAGG - Intronic
1180841765 22:18962247-18962269 AGGGGTCCCAGAGCGGGCTGGGG - Intergenic
1180949310 22:19714185-19714207 CCGGGTCCCAGCGAGGGCGGGGG + Intergenic
1181037271 22:20175765-20175787 GCAGGGGCCAGCGGGGGATGGGG + Intergenic
1181059736 22:20276615-20276637 AGGGGTCCCAGAGCGGGCTGGGG + Intronic
1181126261 22:20703791-20703813 GCGGGTGAGAGTGCGGACTGAGG - Intergenic
1181239591 22:21469102-21469124 GCGGGTGAGAGTGCGGACTGAGG - Intergenic
1181514369 22:23402677-23402699 GCGGGCGCGGGCCCGGGCTGGGG + Intergenic
1181521145 22:23449405-23449427 GGGGGCGCCAGCTCGGGGTGGGG - Intergenic
1181542327 22:23580112-23580134 GCAGGGGCCAGCGCTGCCTGAGG + Exonic
1181793117 22:25283066-25283088 GTGGGGACCAGCGCGGGCCGGGG - Intergenic
1182401304 22:30080055-30080077 GCGGGTCCCAGAGAGGTCTGAGG - Intergenic
1183215052 22:36474076-36474098 TCGGGTGAGAGCCCGGGCTGGGG - Intronic
1183321429 22:37167311-37167333 GAGGGTGCCGGCTGGGGCTGGGG - Intronic
1183683846 22:39350440-39350462 GCGGCCGCCAGGGCGGACTGGGG + Intronic
1184523717 22:45009615-45009637 GCGGGGGCCAGAGCGGGCGCGGG + Exonic
1185055284 22:48575915-48575937 GCCGGAGCGAGCGCGGGCGGCGG + Intronic
1185284167 22:49992973-49992995 GCTGGTGCCAGTGTGGGGTGAGG - Intergenic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1185375735 22:50481919-50481941 GCGGGTCCCCGCCCAGGCTGCGG - Exonic
950086162 3:10259496-10259518 GTGGGTGCAAGAGGGGGCTGAGG + Intronic
950345321 3:12287842-12287864 GCGGGCGCGGGCGCCGGCTGGGG - Intronic
951717386 3:25664251-25664273 GCGGGAGCCGGCGTGGGCGGCGG - Exonic
952354331 3:32570584-32570606 GGGGGAGCCAGCGGGGGCTGAGG + Intronic
952646441 3:35664673-35664695 GCAGGTGGCGGCGGGGGCTGTGG + Intronic
952942653 3:38455421-38455443 GCGGCTGCCACCGAGGGCGGCGG - Intronic
953925364 3:46979922-46979944 GCGGGTGCGGGCGCGGGGCGGGG - Intronic
954131884 3:48565076-48565098 GGGGCTGCCAGCGGGGTCTGGGG - Intronic
956414502 3:69013011-69013033 GCGGGTGCCAGGCAGGGCTCAGG + Intronic
960052350 3:113250781-113250803 CCGGATGCCTGCGGGGGCTGTGG + Exonic
960702476 3:120451305-120451327 GCGGCGGCCCGGGCGGGCTGCGG + Intergenic
961446333 3:126983329-126983351 GCGGGGGCCGGGCCGGGCTGGGG + Intergenic
961636553 3:128336537-128336559 GCGGGTGGCAGGGCTGGCTGAGG - Intronic
961663910 3:128484780-128484802 GCTGGGGCCAGCGGGGGCTGGGG + Intronic
964771232 3:160225944-160225966 GCGGGTACCTGCGTGGACTGGGG - Exonic
966199607 3:177348278-177348300 GTGGTTGCCAGGGTGGGCTGGGG + Intergenic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968729331 4:2262203-2262225 GCGGGCGCCGGGCCGGGCTGGGG + Exonic
968919762 4:3516485-3516507 GAGGCAGCCAGGGCGGGCTGTGG - Intronic
968958354 4:3730423-3730445 GCGGGTGCTGGTGGGGGCTGGGG + Intergenic
968958415 4:3730561-3730583 GTGGGTGCCGGTGGGGGCTGGGG + Intergenic
968958441 4:3730621-3730643 GCGGGTGCCAGTGGGGGCTGGGG + Intergenic
968958455 4:3730651-3730673 GCAGGGGCCAGTGGGGGCTGGGG + Intergenic
968958469 4:3730681-3730703 GCAGGGGCCAGTGGGGGCTGGGG + Intergenic
969327314 4:6451502-6451524 ATGGCAGCCAGCGCGGGCTGGGG + Intronic
969596323 4:8151325-8151347 GTGGGTGCCAGGGCTGGCTCTGG - Intronic
970007785 4:11427783-11427805 CCGGGTGCCGGCGCGGGATGGGG - Intronic
971798553 4:31259319-31259341 GCGGGTGGGAGCTGGGGCTGAGG + Intergenic
972637266 4:40895447-40895469 CCGGGTGCCAGAGCTGGCTGTGG + Intronic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
975406768 4:73998965-73998987 GCCTGTGCCAGAGCGGGCTAGGG + Intergenic
982545142 4:156724410-156724432 TGGGGTCCCAGAGCGGGCTGAGG - Intergenic
985801471 5:2007608-2007630 GCTGTTGCCAGCCCAGGCTGCGG - Intergenic
989484134 5:41968362-41968384 GCGGGCACCGGCGCGGGCTATGG - Intergenic
990869954 5:60420722-60420744 GCGGGAGCCAGCGCAGGGTGGGG + Intronic
991351113 5:65721848-65721870 GCGGGTGCCGGTGCGGGCCCCGG + Intronic
994802173 5:104392625-104392647 GGGGGTGGCAGTGCGGGTTGGGG + Intergenic
995106539 5:108382070-108382092 GCGGGTGCGCGCGCCGGCGGCGG - Exonic
998172533 5:139881005-139881027 GCGTGAGCCAGGGCCGGCTGTGG + Intronic
1001399897 5:171440233-171440255 GGTGGTGCCATCGCGGGCTCAGG + Intronic
1001955400 5:175845288-175845310 GCGGGTCCCAGAGTGGGCTGTGG - Intronic
1002105323 5:176877075-176877097 ACTGGTGCCAGCCCGGCCTGGGG - Intronic
1002182235 5:177436557-177436579 GCGGGGCCCAGCCAGGGCTGGGG + Intronic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1006342106 6:33452602-33452624 GCTGGTCCCAGAGCGGGGTGAGG + Exonic
1007479795 6:42142449-42142471 CCTGGCGCCCGCGCGGGCTGCGG - Intronic
1007927703 6:45663441-45663463 GCCGGTGCCAGGACGGGCGGCGG - Intronic
1013746658 6:113353903-113353925 GAAGGTGTCAGCTCGGGCTGTGG - Intergenic
1015376085 6:132512653-132512675 GAGGGCGCCAGAGCCGGCTGGGG - Intronic
1015724819 6:136289438-136289460 ACGGGAGGCCGCGCGGGCTGTGG + Intronic
1015843304 6:137494901-137494923 GGTGCTGCCAGCGGGGGCTGGGG + Intergenic
1016034624 6:139373676-139373698 GCGGGGGCCAGCGCGCTCGGGGG + Exonic
1017772177 6:157651945-157651967 GCGGGTGACAGCCAGGGATGGGG - Intronic
1018036500 6:159887005-159887027 CCGGGTGCCAGGGCAGGGTGGGG - Intergenic
1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG + Intronic
1019153366 6:170023513-170023535 GCCGCTTCCCGCGCGGGCTGAGG + Intergenic
1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG + Intronic
1019305566 7:332859-332881 GCGGGCGGCAGCGCTGTCTGAGG - Intergenic
1019388485 7:772122-772144 GCGGGTGCCCAAGAGGGCTGAGG + Intronic
1019474540 7:1237588-1237610 GCGTGTGCCAGTGCGCGCGGGGG - Intergenic
1019701574 7:2476952-2476974 GCGGGGGCCAGGGTGGGCTGGGG - Intergenic
1019715829 7:2538874-2538896 GAAGGTGTCAGAGCGGGCTGTGG - Intronic
1019738033 7:2660058-2660080 GCGGGTGGCCGTGCGGGATGGGG - Intronic
1019781013 7:2939713-2939735 GGCGGGGCCAGCGCGGGCAGTGG - Intronic
1020383126 7:7567236-7567258 GCGGGAGCCACCGGGGGCTGCGG + Intronic
1022466788 7:30657355-30657377 GGGGGTCCCAGGGAGGGCTGGGG + Intronic
1022629363 7:32070853-32070875 GCGGGAGCCGGCGCGGGCGGTGG + Intronic
1023017534 7:35982715-35982737 GAGGTGGCCAGCGCGGGCGGGGG - Intergenic
1023812923 7:43926417-43926439 GCGCGCGCAAGCGCAGGCTGCGG + Intronic
1025242627 7:57290560-57290582 GGGGGTGTCAGCGCTGACTGTGG - Intergenic
1029456814 7:100675818-100675840 GGCGGTGCCTGTGCGGGCTGGGG + Intronic
1032548044 7:132759708-132759730 GTGGGTCCCAGAGAGGGCTGGGG + Intergenic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034251294 7:149692830-149692852 GCGGAGGCGAGGGCGGGCTGGGG - Intergenic
1034268687 7:149793042-149793064 GTGGGTCCCAGAGGGGGCTGGGG - Intergenic
1034414116 7:150955912-150955934 GCAGGAGCCTGGGCGGGCTGCGG - Intronic
1034461266 7:151199298-151199320 GGGGGTGCAGGCGGGGGCTGGGG - Intronic
1034490590 7:151391215-151391237 GCGGGGCCCAGCGAGGGCTAGGG + Intronic
1034589824 7:152129385-152129407 GGGGGTGACAGCGCGGGGAGCGG + Intergenic
1035680513 8:1484095-1484117 CTGGGAGCCAGCGTGGGCTGAGG + Intergenic
1036432470 8:8703035-8703057 GCGGGCGCCAGGTCGGGCTCGGG - Exonic
1036660098 8:10702305-10702327 GCAGATGCCAGTGGGGGCTGAGG - Intronic
1036786731 8:11692808-11692830 GCGGGCGCCAGGCCGGGCAGAGG + Intronic
1038644454 8:29350801-29350823 GCGGGGGACAGCGCGGGGGGCGG - Intergenic
1039129637 8:34248389-34248411 GCGGTTGCCACTGCTGGCTGGGG - Intergenic
1041502469 8:58553542-58553564 TCGGGTTCCTGCCCGGGCTGGGG + Intronic
1042695131 8:71547539-71547561 GAGGCTGCCCGGGCGGGCTGGGG + Exonic
1042722900 8:71843910-71843932 GCAGGTGGTAGCGCGGGCGGTGG - Exonic
1044591622 8:93917859-93917881 GCTGCTGCCCGCGCGGGTTGTGG + Intronic
1044997353 8:97849924-97849946 GCGGTTTCCAGAGCGGGCCGTGG + Intronic
1045583434 8:103501596-103501618 GCGGGCGGCGGCGCGGGCTAGGG + Intronic
1049190565 8:141285127-141285149 GCGGGATCCAGCACGGACTGAGG + Intronic
1049211177 8:141387113-141387135 GCAGGTGCCAGATGGGGCTGAGG + Intergenic
1049289138 8:141792279-141792301 GTGGGTGCCAGGGTGGCCTGAGG + Intergenic
1049639118 8:143706576-143706598 GCGGGTGTCAGAGCCGCCTGGGG + Intronic
1049657053 8:143803610-143803632 GTGGGGCCCAGGGCGGGCTGGGG + Intronic
1049673098 8:143878345-143878367 GCGGGTGCGGGTGCGGGCTCGGG - Intronic
1049708891 8:144054952-144054974 GCAGGGGCCAGAGCGGGGTGGGG + Intronic
1057075623 9:92136753-92136775 CAGGGGGCCAGCGTGGGCTGGGG + Intergenic
1057922218 9:99105882-99105904 GCGGGAGTCAGGGCGGCCTGCGG - Intronic
1058486597 9:105448099-105448121 GGCGGTGCCGGTGCGGGCTGGGG + Exonic
1058851152 9:109013240-109013262 GCGGCCGCCATCGCGGGCCGCGG + Intronic
1060200928 9:121651538-121651560 GCCGGTGCCAGCCCGGCCTCCGG + Intronic
1060555629 9:124505934-124505956 CCAGGTGCCAGCGGGGGCGGAGG - Intronic
1060643968 9:125262168-125262190 GCAGGAGCCAGGGCGGCCTGGGG + Intronic
1060765603 9:126293391-126293413 GCTGGAGCCAGCAGGGGCTGGGG + Intergenic
1061193209 9:129094169-129094191 GCGGATGCCGGGGTGGGCTGGGG - Intergenic
1061958332 9:133975191-133975213 GGGGGTGCCGGGGCAGGCTGGGG - Intronic
1062192907 9:135256877-135256899 GCGCGTGCCAGGCTGGGCTGGGG - Intergenic
1062446423 9:136597262-136597284 TCGGGTGCCAGGCTGGGCTGGGG - Intergenic
1062718750 9:138023863-138023885 GCGGGCCCCAGCGGTGGCTGCGG + Intronic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1186274695 X:7927043-7927065 GCGGACGCCAGCGCAGCCTGCGG - Intronic
1187154621 X:16712017-16712039 GCGGGCGCTGGCGCGGGCGGAGG + Exonic
1188514332 X:30968989-30969011 GCGGGTGCCAACCAGGGTTGAGG - Intronic
1194316235 X:92380206-92380228 GCAGGTGCCAGCGTGGGCACTGG - Intronic
1200624279 Y:5491779-5491801 GCAGGTGCCAGCGTGGGCACTGG - Intronic