ID: 1186108326

View in Genome Browser
Species Human (GRCh38)
Location X:6228829-6228851
Sequence CTGTGCTAAGAGACAGAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186108324_1186108326 2 Left 1186108324 X:6228804-6228826 CCAAGCTAGTGGCTGAATAAGAG 0: 2
1: 0
2: 0
3: 15
4: 101
Right 1186108326 X:6228829-6228851 CTGTGCTAAGAGACAGAGAAGGG 0: 1
1: 1
2: 0
3: 38
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186108326 Original CRISPR CTGTGCTAAGAGACAGAGAA GGG Exonic
902227162 1:15003721-15003743 CTGAGCTGAGAGACAAGGAATGG - Intronic
902474212 1:16672685-16672707 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
902484591 1:16734757-16734779 CTGTGCCAAGAGACCCAGCAAGG - Intergenic
902495470 1:16869164-16869186 CTGTGCCAAGAGACCCAGCAAGG - Intronic
903370974 1:22836012-22836034 CTGTGAGATGAAACAGAGAAAGG + Intronic
904285061 1:29448707-29448729 CTGACCTGAGAGGCAGAGAAGGG - Intergenic
905499221 1:38423171-38423193 ATGTGGTAAAAGACAAAGAAAGG + Intergenic
906908847 1:49924986-49925008 CTGGGCTAAGAGCCAGTAAATGG + Intronic
907060447 1:51417656-51417678 GTGGACCAAGAGACAGAGAAGGG + Intronic
909078830 1:71085225-71085247 TTCAGCAAAGAGACAGAGAAAGG - Intergenic
909429720 1:75573096-75573118 CTGAGCTGAGCGACAGAGCAAGG + Intronic
911370905 1:96993631-96993653 TTGTGCTAATAGACTGAGGAGGG - Intergenic
912449153 1:109758858-109758880 CTGTCCTCAGAGACTGAGATGGG - Intronic
912573667 1:110644004-110644026 CTGAGCTAAGAGGCAGAGGGTGG - Intergenic
913661943 1:121012390-121012412 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
914013320 1:143795575-143795597 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
914164505 1:145165610-145165632 CTGTGCCAAGAGACCCAGCAAGG - Intergenic
914651942 1:149704184-149704206 CTGTGCCAAGAGACCCAGCAAGG + Exonic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915247315 1:154565732-154565754 CTGTTCTAACAGACATATAAAGG - Intergenic
915252650 1:154601625-154601647 CTGTGCTAATTGACATGGAAAGG - Exonic
915924893 1:160009464-160009486 GAGTGCTATGAGACAGAGACAGG - Intergenic
915928105 1:160039917-160039939 CTGTGGTAAGGGTCAGGGAAGGG - Exonic
916012388 1:160717958-160717980 ATGTGCTAGCAGACAGGGAAAGG - Intergenic
917152526 1:171960165-171960187 ATGTGATAAGAGGCAGAGACTGG + Intronic
918006650 1:180547598-180547620 GTATTCTAGGAGACAGAGAATGG + Intergenic
918012311 1:180598767-180598789 CTGGGATAACAGACAGAAAAAGG - Intergenic
918280784 1:183003460-183003482 CTGGGCTAAGACTCAAAGAAGGG + Intergenic
918615936 1:186543520-186543542 GAGTGCAAAGAGACAAAGAAAGG + Intergenic
921346640 1:214193044-214193066 CTGTGCCTAGAGACAAAGGATGG - Intergenic
923440173 1:234010845-234010867 CTATAAAAAGAGACAGAGAAGGG + Intronic
923449916 1:234106828-234106850 CTTTGCTGAGACACAGAGGACGG + Intronic
923603880 1:235425924-235425946 CTGTGCTCAGGGACAGAGCAGGG - Intronic
923981029 1:239324136-239324158 ATGTGCTAAGAGAAAGAAATTGG - Intergenic
924478143 1:244399804-244399826 CTGTTACAAGAGACAAAGAAGGG - Intergenic
924683519 1:246262661-246262683 CTGTGCTAGGTGTCAGAGACCGG - Intronic
1063365990 10:5491233-5491255 CTGTCCCAAGAGACGAAGAAGGG - Intergenic
1063791308 10:9451296-9451318 GTGTGCCTAGAGACAGAGGAGGG + Intergenic
1064107301 10:12510916-12510938 CTCTGCTAAGAAACGGAGACTGG + Intronic
1065436511 10:25708519-25708541 CTGTGCTTGGAGACACTGAAAGG + Intergenic
1066329999 10:34411134-34411156 CTGCTCTAACAGACAGAGATGGG + Intronic
1066443867 10:35464179-35464201 CTGGGCTAAGGCACAGAGGAGGG - Intronic
1067410389 10:46059499-46059521 CATTTCCAAGAGACAGAGAAAGG + Intergenic
1068392501 10:56416149-56416171 CTGTGATAAAAGAAACAGAATGG - Intergenic
1068489645 10:57706967-57706989 CAGAGCCAACAGACAGAGAAGGG + Intergenic
1068706891 10:60086879-60086901 CTGGGCCTAGAGACAGAGAAAGG + Exonic
1069170838 10:65226800-65226822 GTGTGCGCAGAGAGAGAGAAGGG + Intergenic
1069373287 10:67769072-67769094 CAGTGCTAGAAGACAAAGAATGG - Intergenic
1070388176 10:75945999-75946021 CTATTCTAGCAGACAGAGAAAGG - Intronic
1071467234 10:85952109-85952131 CTGTGCTATAAGAGACAGAAAGG - Intronic
1072257656 10:93635744-93635766 CTGGGCTGAGAGAGAGAGACAGG + Intronic
1072295882 10:94009228-94009250 CAGGGGCAAGAGACAGAGAAGGG + Intronic
1075399732 10:122152110-122152132 CTGGGCTAAGAGGCAAAGGATGG + Intronic
1075462889 10:122630603-122630625 CAGTGCCAAGAGAAAGAGAATGG - Intronic
1077200292 11:1303539-1303561 CTGTGCAAAGAAACAGGGCAAGG + Intronic
1077355578 11:2115251-2115273 CTGTTCTGGGAGACAGAGAAGGG + Intergenic
1078081198 11:8205874-8205896 CTGTGTTAAGACACAGCCAAGGG + Intergenic
1078404847 11:11061502-11061524 CTCTGGTAAGAGACAGGGCAGGG - Intergenic
1079393496 11:20042405-20042427 CTGTGGCAAGGGACAGAGAGAGG - Intronic
1079564129 11:21860135-21860157 CTGTGCTAAGAGAGAGAATATGG - Intergenic
1081787160 11:45755807-45755829 CAGTGCCACAAGACAGAGAAGGG + Intergenic
1081966681 11:47174341-47174363 CTGTGCTTGGGGACAGTGAAAGG - Intronic
1083537525 11:63484245-63484267 CTATTCCAAAAGACAGAGAAAGG + Intronic
1083947081 11:65929714-65929736 CTGTTATAAGCAACAGAGAATGG + Intergenic
1085162281 11:74359812-74359834 CTGTACTAGGGGACAGAGATGGG + Intronic
1086401944 11:86468085-86468107 CTGTGGTCAGAGACTGAGATGGG - Intronic
1086722109 11:90133912-90133934 CTGTGCTATGGGAGAGACAAAGG + Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1087118954 11:94552937-94552959 CTGTGGTAGGAAACTGAGAAAGG + Intronic
1087197512 11:95315907-95315929 CTTTGCTGAGAGACACATAAAGG - Intergenic
1087350317 11:97022953-97022975 CTGTAAGAAGAGACAAAGAAAGG + Intergenic
1087434971 11:98103500-98103522 CTTTAGCAAGAGACAGAGAAAGG - Intergenic
1088527786 11:110775292-110775314 CGATGCTAAGTGACACAGAATGG - Intergenic
1089801239 11:121030143-121030165 CTCTGCCAAGAGACAGGAAAAGG + Intronic
1089970922 11:122692648-122692670 ATGTGCTAAAACTCAGAGAAGGG + Intronic
1091022550 11:132113843-132113865 CTGGGCTCAGAGACAGGAAAGGG + Intronic
1091086052 11:132723014-132723036 CTCTGCTCAGACACAGAAAATGG + Intronic
1091706300 12:2695612-2695634 CTTTGCTTAGGGACAGGGAAAGG - Intronic
1091821217 12:3476566-3476588 CTATCCTAAGAGAGAGAGATGGG - Intronic
1092405214 12:8217054-8217076 TTTTCCAAAGAGACAGAGAATGG + Intergenic
1092759066 12:11792789-11792811 CTGAGCTAAGGGGCAGAAAAAGG + Intronic
1093748914 12:22776433-22776455 ATGTGGTAAGAGGCAGAGGAAGG + Intergenic
1093787672 12:23211557-23211579 CTCTGCCAAGAGAGAGTGAAGGG + Intergenic
1094117992 12:26938276-26938298 CTGGGTGGAGAGACAGAGAAGGG - Exonic
1094395262 12:29998619-29998641 CTGTGCTAGGTGTCAGAGATAGG - Intergenic
1095370309 12:41458953-41458975 CTGAGATAGGAAACAGAGAAGGG + Intronic
1095514462 12:42990701-42990723 CTGAGCTAAGCCACATAGAATGG - Intergenic
1095879217 12:47114520-47114542 ATGTGCTAAGAGCCAGACACTGG - Intronic
1097302011 12:58028852-58028874 CTCTACTAAGGGAAAGAGAAGGG + Intergenic
1097380303 12:58887370-58887392 CTGTCCTAAGAGAAAGAAAAGGG - Intronic
1099244937 12:80183261-80183283 ATTTGCTGAGAGAGAGAGAAAGG - Intergenic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1102022469 12:109693383-109693405 CTGTGGTAGGAGAGAGAGAGAGG + Intergenic
1102182254 12:110921406-110921428 CTGTGCAGAGAAACAAAGAAGGG - Intergenic
1103167224 12:118780381-118780403 CTGCGCTAAGAGACAGACCTAGG + Intergenic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1103897899 12:124286101-124286123 CTCTGCAAAGAGCCTGAGAAAGG - Intronic
1104118374 12:125772717-125772739 CTGTGATAAGAGACACTGAAAGG - Intergenic
1104615479 12:130264667-130264689 ATGTCCTGAGAGACAGAGAGAGG + Intergenic
1106485011 13:30164393-30164415 GTCTGCTTAGAGAGAGAGAATGG + Intergenic
1107340975 13:39405462-39405484 CTGTGCTAAAAGAAACAGATTGG + Intronic
1107410509 13:40153667-40153689 CAGTGCCAACAGACAGAAAAGGG - Intergenic
1108906413 13:55479836-55479858 TTGGGCAAAGAGAGAGAGAATGG - Intergenic
1110200682 13:72846432-72846454 CTGTGCTAAGAGACTGGAGAGGG - Intronic
1110563103 13:76930286-76930308 CGGTGCTTGGAGATAGAGAAAGG - Intergenic
1110615415 13:77536308-77536330 CTGAGCTATGAGAGAGAGAGAGG + Intronic
1111105030 13:83634044-83634066 CTTTGCTAACAGACAGGGAAAGG - Intergenic
1111294137 13:86257699-86257721 CAGGGGTAAGAGGCAGAGAAAGG - Intergenic
1111702111 13:91704246-91704268 CTGTAAAAAGAGACAAAGAAGGG - Intronic
1112196807 13:97234430-97234452 CTGTGATAAGAGAAAGAGGTGGG + Intronic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1112475722 13:99729673-99729695 ATTTGCTAATTGACAGAGAAAGG - Intronic
1112534815 13:100242303-100242325 CTATTCTAAGAGACAAAGAAGGG + Intronic
1113135421 13:107083535-107083557 CTCTGATTAGAGACAGAGCAGGG - Intergenic
1113640074 13:111951119-111951141 CTGGGCCAAGTGACAGTGAATGG + Intergenic
1115198038 14:30822885-30822907 TTGGGCTGAGAGACAGAGAGTGG - Intergenic
1115242595 14:31264560-31264582 CTGTCCTTAGAGAAAGAGTATGG + Intergenic
1115296843 14:31837913-31837935 CTTTGTTCAGAGACAGTGAAAGG - Intronic
1116300568 14:43176045-43176067 CTGTTCACAGAGAAAGAGAATGG - Intergenic
1116611239 14:47074809-47074831 CTGTGCTGAGATACAGACTATGG - Intronic
1118044952 14:61959002-61959024 CTGTCACAAGAGACAAAGAAGGG - Intergenic
1118058151 14:62104670-62104692 CTGTGCTAAGACAATGAGATTGG + Exonic
1119765951 14:77187706-77187728 CTGTTCCCAGAGACAGAGGAAGG + Intronic
1119858109 14:77916193-77916215 CTATGGGAAGACACAGAGAAAGG - Intronic
1121939827 14:98059478-98059500 CTGTGAGAGGAGAGAGAGAAAGG + Intergenic
1121990318 14:98550981-98551003 CTGTGCTAAGTCACTGAGATGGG + Intergenic
1124051773 15:26203109-26203131 CAGTGCTTGGAGATAGAGAAAGG - Intergenic
1124985439 15:34606005-34606027 CTCTACTAAGACCCAGAGAAAGG + Intergenic
1125453818 15:39836714-39836736 TTGTTCTAAGAGAAGGAGAAAGG + Intronic
1126544131 15:49853964-49853986 TAGTCCCAAGAGACAGAGAAGGG + Intergenic
1127012701 15:54647465-54647487 CTGTAGGAAGAGACAAAGAAAGG + Intergenic
1127022539 15:54764785-54764807 CTGTAGGAAGAGACAAAGAAGGG + Intergenic
1127035419 15:54911050-54911072 CTGTAAGAAGAGACAAAGAAGGG + Intergenic
1128315679 15:66657772-66657794 CTCTGCTGAGAGACAGTGAGCGG - Intronic
1129291214 15:74569298-74569320 ATCTGCTAAAAGACAGAGATGGG - Intronic
1131018021 15:89073966-89073988 CAGTGCTAGGAGAAAGAGAAAGG + Intergenic
1131771527 15:95742952-95742974 CTGTGCTAAGGCACTGAGACAGG + Intergenic
1133424195 16:5673448-5673470 CTGTGCTGAAAGCCAGAGAGAGG - Intergenic
1134675140 16:16085154-16085176 CAGTGGTGAGAGGCAGAGAATGG - Intronic
1135124609 16:19798039-19798061 CAGGGGTAAGAGGCAGAGAAAGG + Intronic
1135980371 16:27142418-27142440 CTCTGGTTAGAGCCAGAGAAAGG - Intergenic
1137272790 16:46913426-46913448 CTATTCTCACAGACAGAGAAGGG - Intronic
1137591080 16:49694363-49694385 CTGTGCCAAGAGAAACAGAGAGG + Intronic
1138660177 16:58512029-58512051 ATGTGCTATGAGACAGAAACAGG - Exonic
1138745204 16:59355146-59355168 CTGTTCTAAGCAACAGAAAATGG + Intergenic
1139547656 16:67657221-67657243 CCGTTCTAAGGGACACAGAAAGG - Exonic
1139597609 16:67967590-67967612 CTGGGGTAGGAGATAGAGAAAGG + Intronic
1140056290 16:71528625-71528647 TTGAGCAAAGAGAGAGAGAATGG - Intronic
1141091512 16:81133527-81133549 CTGTGCTGAGAGCCAGCGAGTGG + Intergenic
1141947271 16:87319240-87319262 CTCTGATAAGAGGCAGAGCAAGG - Intronic
1142687725 17:1587375-1587397 CTGTGCTCAGAGAGAGGGAAAGG + Intronic
1143289823 17:5820296-5820318 CAGTGGTAAGAGATAGAGAGGGG - Intronic
1143458120 17:7080844-7080866 CTGTGCTGAGAGCCAGAGCAGGG - Intergenic
1143851580 17:9816179-9816201 CTGTTTTAAGCAACAGAGAATGG + Intronic
1145405027 17:22581917-22581939 CTGTGCTAAGAAAGAGAAATTGG - Intergenic
1145905159 17:28512230-28512252 CTGTGATAAGGGCCAAAGAATGG - Intronic
1147914706 17:43879445-43879467 CTGTCCTAGGAACCAGAGAAAGG + Intronic
1148354741 17:46968342-46968364 CAGTGCTGAGAGACAGAGTTGGG - Intronic
1148806402 17:50266222-50266244 CTCAGCTAGGAGAGAGAGAAAGG - Intergenic
1148817565 17:50341009-50341031 TTGGGCTTACAGACAGAGAAGGG + Intergenic
1149125693 17:53228731-53228753 CTGAACTAAGAGTGAGAGAATGG - Intergenic
1149290631 17:55214822-55214844 CTGTGCTAGTAGATACAGAAGGG - Intergenic
1149356664 17:55846162-55846184 CTGTGTAAAGCCACAGAGAAAGG - Intergenic
1149446055 17:56714266-56714288 CTGGGCAAAGAGACATAGGAAGG + Intergenic
1149612463 17:57967608-57967630 GTCTGCGAAGAGAGAGAGAAAGG - Intergenic
1150178354 17:63087187-63087209 CTGTTGGAAGAGACAGAGCAAGG - Intronic
1150820689 17:68431819-68431841 CTGTGCTCACAGACAGAAACGGG + Intronic
1150944453 17:69729867-69729889 CTGTGCAAAGACACAGAAAAAGG - Intergenic
1151178953 17:72311986-72312008 CTCTGCTAACAGACAGGGGAGGG + Intergenic
1152469412 17:80482578-80482600 CTGGCCTCAGAGACGGAGAATGG - Intergenic
1153041040 18:812723-812745 CTGGGCCAAGGAACAGAGAAAGG - Intergenic
1153585495 18:6616149-6616171 ATGTGCAAAGAGACAGAGGAGGG + Intergenic
1153868474 18:9295127-9295149 CTGTGCATAGAAACAGGGAAAGG + Intergenic
1154043173 18:10878676-10878698 CTGTGCTTAGAGACAGTGTCTGG - Intronic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1155588127 18:27391974-27391996 GTGTGCCAAGAGAAAGAGAGAGG + Intergenic
1155990463 18:32274249-32274271 CTGTTCTAAGAGTAAGAGATAGG - Intronic
1156700359 18:39817702-39817724 CTGGGATATGACACAGAGAATGG + Intergenic
1158811405 18:61040672-61040694 CTGTGCTAAGTGAAAGAAAGCGG - Intergenic
1159968188 18:74617498-74617520 ATGTCATAAAAGACAGAGAAAGG - Intronic
1161242019 19:3227983-3228005 CCGTGCTGAGACTCAGAGAAAGG + Intronic
1161784307 19:6313786-6313808 TTGTCCTATGAGATAGAGAAAGG - Intronic
1162095277 19:8306467-8306489 CTGGGCCAAGGGACAGAGGAAGG + Intronic
1162115150 19:8424689-8424711 CAGAGCCAAGAGACAGGGAAAGG - Intronic
1163125241 19:15240924-15240946 CTGTGCTGACAGACAGTGGAAGG - Intronic
1163367106 19:16881354-16881376 CTGTGGCAAGGGACAGAGAGTGG + Intergenic
1163500985 19:17676042-17676064 CTGTGGAGAGAGACAGAGATAGG + Intronic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1165449720 19:35875003-35875025 CTGAGCTGAGAGACTGGGAAGGG - Intronic
1168697904 19:58415861-58415883 CTCTGCACAGATACAGAGAAGGG - Intronic
1202707589 1_KI270713v1_random:35089-35111 CTGTGCCAAGAGACCCAGCAAGG + Intergenic
924973038 2:148365-148387 CTGTCATAAGATACAAAGAAGGG - Intergenic
925626466 2:5846455-5846477 CTGGGAAATGAGACAGAGAAGGG - Intergenic
926417809 2:12667445-12667467 CTGTGCTAGGATCCAGAGATGGG - Intergenic
926566560 2:14481995-14482017 CAGTTCTGAGAAACAGAGAAAGG + Intergenic
927261669 2:21097898-21097920 TTCTGCTAAGAGAAAGCGAATGG + Intergenic
927485031 2:23482723-23482745 CTGTTGTAAGAGAGAGAGACAGG - Intronic
928486569 2:31738302-31738324 CTTTGCTAAGTGACTGGGAAAGG - Intergenic
929197379 2:39199443-39199465 CTATTCCAAAAGACAGAGAAAGG + Intronic
929280255 2:40070600-40070622 CTCTACTAAGAGACACAGAGTGG - Intergenic
930306325 2:49679228-49679250 ATGTGAGAAGGGACAGAGAAAGG + Intergenic
930833244 2:55768082-55768104 CAGTTCTATGAGACAGAGAAGGG - Intergenic
931317846 2:61149452-61149474 AAGTGCTGAGATACAGAGAAGGG - Intronic
931745067 2:65284708-65284730 CTGTCATAAAAGACAAAGAAAGG - Intergenic
932542991 2:72676235-72676257 CTGAGTTGAGAGACAGAAAATGG - Intronic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
933222717 2:79709309-79709331 CTATGAAAAGAGACAGAGAGGGG + Intronic
933438860 2:82283808-82283830 CTGTGATAACAGACACAGCACGG + Intergenic
935572002 2:104671478-104671500 CTGAGCCAGGAGACAGAGAAGGG + Intergenic
935811536 2:106802829-106802851 CTGTGGTAAGAGACAGAGAAAGG - Exonic
936644047 2:114348643-114348665 GTCTGCTAAGTGACAGAGCAAGG + Intergenic
936674482 2:114699305-114699327 GTGTGTTGAGAGAAAGAGAAAGG + Intronic
937259419 2:120576144-120576166 CTCTGCAGAGACACAGAGAAGGG + Intergenic
937533918 2:122863183-122863205 AGGTGCTGAGAGATAGAGAAAGG - Intergenic
939354154 2:141079379-141079401 ATGTGCTGAGAGACTGTGAAAGG + Intronic
940608634 2:155961808-155961830 CTGTGCTTTCAGACAGCGAAAGG - Intergenic
940886871 2:158997886-158997908 CACTTCTAAGAGACAGAGTATGG + Intronic
941072760 2:160972785-160972807 CTGTGTGAAGAGATAGAAAATGG - Intergenic
941451603 2:165666686-165666708 TGGTGTTAAGAGAGAGAGAAAGG + Intronic
941625757 2:167828556-167828578 CTTTCCTGAGAGACAAAGAAGGG - Intergenic
942558291 2:177194762-177194784 ATGTGCTAAGAGAAAGGAAAAGG + Intergenic
942836003 2:180299299-180299321 GTGTGCTAAGAGACCCAGATAGG - Intergenic
942841395 2:180365957-180365979 CTGTGTCATGAGACAGAAAATGG + Intergenic
944656680 2:201882595-201882617 CGGTGCCAAGAGACAGGGAAAGG + Intronic
945284173 2:208065711-208065733 ATGTCCTAAGAGACAGGAAATGG - Intergenic
945940811 2:215947987-215948009 CTTTGCTAAGAAACAGTAAAAGG - Intronic
946918860 2:224556528-224556550 ATGTGCTGAAAGACAAAGAAAGG + Intronic
947614806 2:231548964-231548986 CTGGGCAAAGAGCCAGGGAAAGG - Intergenic
948276556 2:236713457-236713479 CTGTCCTCAGAGACACAGCAGGG + Intergenic
1169653758 20:7898795-7898817 CTGTCCTAATAGACATAGCATGG + Intronic
1170044073 20:12066813-12066835 CTGTGCTCAAAGCCAAAGAAGGG - Intergenic
1170198093 20:13711688-13711710 CTTTGCTTAGAGGCAAAGAAAGG - Intergenic
1170814850 20:19705089-19705111 CTTTGCTAAAAGACAGGGCAGGG + Intronic
1172151300 20:32792468-32792490 CTGTGGTATGTGACAGAGGAAGG - Intronic
1172967288 20:38845995-38846017 CTGTGTCAAGTGACAGAGGAGGG + Intronic
1173285676 20:41669856-41669878 ATGTGGTGAGAGACAGAGGAAGG + Intergenic
1173576043 20:44113502-44113524 CTCTGCAAAGAGACAGCAAAAGG + Exonic
1174256235 20:49257660-49257682 CTGGGCTAAGAGAGAGAAACAGG + Exonic
1174274508 20:49393951-49393973 CTGTGCCAAGACACAAAGACAGG + Intronic
1174784510 20:53419961-53419983 CGGTGCAGAGAGACAGAGAGGGG - Intronic
1175366420 20:58459494-58459516 CTGTGATAAGAGCTAGAGATAGG + Exonic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1176296370 21:5075527-5075549 CTATGCTGAGAGGCCGAGAAAGG - Intergenic
1177458920 21:21383350-21383372 CTCAGCTAGGAGTCAGAGAAGGG - Intronic
1178016697 21:28355055-28355077 CTGTACTAGGAGAGAGAGAGGGG + Intergenic
1179860679 21:44186594-44186616 CTATGCTGAGAGGCCGAGAAAGG + Intergenic
1180178599 21:46105916-46105938 CTCTGTTAAAAGACAGAGATTGG + Intronic
1180756072 22:18162147-18162169 CTCTACTGAGAGGCAGAGAAAGG - Intronic
1181075695 22:20375256-20375278 CTCTACTGAGAGGCAGAGAAAGG + Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182213530 22:28696676-28696698 TTGTGCTTAGAGAGAGAGGAGGG - Intronic
1184554667 22:45226684-45226706 CTCTGCTCAGACACAGAAAATGG + Intronic
1184657387 22:45948596-45948618 CTGTGGCAAGAGGCAGAGGAGGG - Intronic
949146707 3:709703-709725 CTGTGGCAAGAGAAACAGAAGGG - Intergenic
949156855 3:838055-838077 ATGTGCTAAAAAAAAGAGAAGGG + Intergenic
949574162 3:5322668-5322690 CAGTGCTTAGGAACAGAGAAAGG + Intergenic
950222483 3:11206853-11206875 CTGTGGAAAGGGACAGACAAGGG + Intronic
950295433 3:11825671-11825693 CTCTCCTATGAGAGAGAGAATGG - Intronic
951651959 3:24960518-24960540 TTGGGCTAAGAGGCAGAGTAAGG + Intergenic
952430354 3:33218199-33218221 CGAGGCTAAGAGAGAGAGAATGG - Intronic
954062708 3:48081950-48081972 AAGTGCTAAAAGACAAAGAAAGG + Intronic
954284191 3:49607142-49607164 CAGTGCTAAGGGAGAGATAATGG - Intronic
954633610 3:52059705-52059727 CTGTGCTCAGAGACTGAGCTGGG - Intergenic
957460157 3:80507222-80507244 CAGTGTTGAAAGACAGAGAATGG + Intergenic
957485040 3:80849978-80850000 CTGTGTGAAAAGACAGAGAAGGG + Intergenic
958093712 3:88912451-88912473 ATTTGCTAAGAGGCAGACAAAGG + Intergenic
959000334 3:100956848-100956870 CAGTGCAAAGACTCAGAGAAAGG + Intronic
959652720 3:108767365-108767387 CTTTGCTGAGAGCCAGATAAGGG + Intergenic
960403385 3:117230739-117230761 CTGGGTTGAGAGAAAGAGAATGG + Intergenic
961411885 3:126728196-126728218 CTGTGCCAAGACACAGTGATAGG + Intronic
962511077 3:136101312-136101334 CTGTGTTAAGAGGATGAGAAGGG + Intronic
962899685 3:139749415-139749437 CTGTCACAAGAGACAAAGAAGGG - Intergenic
964146009 3:153464251-153464273 CTGTGATAAGCAACAGAAAATGG + Intergenic
964928838 3:161990676-161990698 CTGTGGGAAGGGACAGATAAAGG - Intergenic
965145488 3:164896701-164896723 CTGTGCTCTGTGACAGAGAAAGG - Intergenic
966499960 3:180628000-180628022 CTGTGTGAAGAGACACAGGAAGG + Intronic
966827101 3:183974031-183974053 ACGTGCTAAGAGGCAGAGAAGGG + Intronic
967989884 3:195122883-195122905 CTGTGCTCAGAGACAGGGTGTGG + Intronic
968780500 4:2576819-2576841 CTGTGGTAATAGGCACAGAAAGG + Intronic
968903294 4:3440906-3440928 CTGTGCAGAGGGAGAGAGAATGG - Intergenic
968929288 4:3570041-3570063 CAGTGGTTAGAGACAGAAAATGG - Intergenic
969760900 4:9180939-9180961 TTTTCCAAAGAGACAGAGAATGG - Intergenic
971152171 4:24044919-24044941 CGGTGCTCAGAGAGAAAGAAAGG + Intergenic
971859537 4:32086787-32086809 CTGGGCCTAGAGAGAGAGAAAGG + Intergenic
973003418 4:44980660-44980682 CTTTCCTCAGAGACAGAGCAAGG - Intergenic
973047444 4:45552269-45552291 CTTAGCTAAGAGAAAGACAAAGG - Intergenic
973545952 4:51982217-51982239 CTTTTCTAAGAGAAAAAGAATGG + Intergenic
974067204 4:57089717-57089739 TTGTCAAAAGAGACAGAGAAGGG - Intronic
974411125 4:61541744-61541766 CTTTGATAAGAGAGAAAGAAAGG - Intronic
977069699 4:92369331-92369353 CTGTGGAAAAAGACATAGAAAGG + Intronic
977630151 4:99233585-99233607 CTGTTATAAGAGTCAAAGAAGGG - Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978397068 4:108292466-108292488 CTGTGCTTAGAGCCAAGGAATGG + Intergenic
978437466 4:108701120-108701142 TGGTGCTTAGAGGCAGAGAAGGG - Intergenic
978456576 4:108899181-108899203 CTGAGCAAAAAGACAGAGATTGG + Intronic
978679227 4:111358296-111358318 CTATGCTAAAATATAGAGAATGG - Intergenic
979097142 4:116564855-116564877 CTCTACTAAAAGACAGAGAATGG + Intergenic
981108468 4:140907693-140907715 CTATGCTCAGAGACAGAACAGGG - Intronic
981203528 4:142012539-142012561 CTGTAAGAAGAGACAAAGAAAGG - Intergenic
981215233 4:142157871-142157893 ATGTGCTAAGAGAAAAAGACGGG - Intronic
981526269 4:145709399-145709421 ATGTGCCAAGAGACAGGGAAAGG + Intronic
981733118 4:147920858-147920880 CTCAGCAAAGATACAGAGAAAGG + Intronic
981833255 4:149026537-149026559 CTGTAATAAAAAACAGAGAATGG + Intergenic
982449401 4:155534044-155534066 CTGGGATCAGAGGCAGAGAAAGG - Intergenic
982660396 4:158199993-158200015 CTGTGCAAAGCTTCAGAGAATGG + Intergenic
983428056 4:167612353-167612375 CAATGCTAAGGTACAGAGAAAGG + Intergenic
983825996 4:172261142-172261164 CTATTCTAAAAGACAGAGAAAGG - Intronic
984120035 4:175730772-175730794 GTGTGGTAAGAGATCGAGAACGG - Intronic
985150574 4:186943219-186943241 CTGTGCAAGGAGACAGAGCAGGG + Intergenic
985919124 5:2954658-2954680 CTGTAAAAAGAGACAAAGAAGGG - Intergenic
986222726 5:5784122-5784144 CAGTGCTAGGAGTCAGAGAGAGG - Intergenic
986250811 5:6056978-6057000 GTGTCTTAAAAGACAGAGAAAGG + Intergenic
986802753 5:11278859-11278881 TTGTGGAAAGAGACAAAGAAGGG - Intronic
987164659 5:15183441-15183463 CTCTTCTCAGAGACAAAGAATGG + Intergenic
987915870 5:24213687-24213709 CTGTGCGAAGAGATATAAAAAGG - Intergenic
988031138 5:25764248-25764270 CTTTATTAAGAGACAGAAAAAGG + Intergenic
988874848 5:35432465-35432487 AGGTGGTAAGAGAGAGAGAAAGG - Intergenic
989202751 5:38781555-38781577 ATGTGTTATGAGACTGAGAAAGG + Intergenic
989799555 5:45520458-45520480 CTGTGCTATGTAACAGACAATGG - Intronic
990753010 5:59038970-59038992 CTCTGCGAAGAGACAGGGAAAGG + Exonic
991457324 5:66818260-66818282 TTGAACTAAGAGACGGAGAAAGG + Intronic
992880547 5:81105185-81105207 CTGCACTAACAGTCAGAGAATGG - Intronic
993474633 5:88349612-88349634 CCCTGCTAAGAGACACAGACTGG - Intergenic
994805356 5:104440290-104440312 CTATGCTAAGAAACAAAGAGAGG - Intergenic
995148242 5:108810852-108810874 CTGTGCAAAGATACAGGTAAAGG - Intronic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996557219 5:124790943-124790965 ATGTCTTAAAAGACAGAGAAGGG - Intergenic
996653726 5:125914053-125914075 CACTGCTATGGGACAGAGAAAGG + Intergenic
997707008 5:135965163-135965185 CTGTGCTGAGTGAGAAAGAATGG + Intergenic
998375850 5:141690078-141690100 GTGGGCTAATAGACAAAGAAGGG - Intergenic
998503973 5:142657363-142657385 CTGTGCAGAGAAGCAGAGAACGG - Intronic
999214549 5:149921166-149921188 CTGTGGAAAGAGACCCAGAAAGG - Intronic
999925668 5:156373674-156373696 CAGTGCTAAGAGAAAATGAACGG + Intronic
1001415932 5:171544897-171544919 CAGGGCTATGAGACAGAGAAGGG + Intergenic
1001415934 5:171544915-171544937 AAGGGCTATGAGACAGAGAAGGG + Intergenic
1001642888 5:173257706-173257728 CTGTGCTAAGACAGAGCCAATGG + Intergenic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002792897 6:448629-448651 CTGTTATAAGTGACAGAGAATGG + Intergenic
1003400983 6:5790582-5790604 CGGTCCTAAGAGACAGTGCATGG - Intergenic
1003845286 6:10167374-10167396 CTGAGCTAAGAGACTAAAAATGG - Intronic
1004380615 6:15129171-15129193 CTGTGCTAATAGACTGAGTGGGG - Intergenic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006677027 6:35771758-35771780 CTGTCCTCACAGACAGAGCAGGG + Intergenic
1006872866 6:37269167-37269189 CTGGGCTAAAAGACAGTGAAGGG - Intronic
1007327217 6:41072218-41072240 CTAGGGTAGGAGACAGAGAATGG - Intronic
1008181543 6:48336577-48336599 ATGTGCCAAGAGACAGGTAATGG + Intergenic
1011028430 6:82894728-82894750 CTGTTATAATAGACAGAGGAAGG + Intronic
1011589355 6:88956496-88956518 CTATTCCAAAAGACAGAGAAAGG + Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011933938 6:92751613-92751635 CTGTAATAAGAGAAAAAGAAGGG - Intergenic
1012169676 6:96002481-96002503 CTGTGGCAAGACACAGAGTAGGG - Intergenic
1012199886 6:96392769-96392791 CTGTGCTGAGTGACAGTGCAAGG - Intergenic
1014528321 6:122528125-122528147 CTGTTATAAGAGACTAAGAAGGG - Intronic
1014936575 6:127392459-127392481 GAGTGCTAAAAGATAGAGAAAGG + Intergenic
1015512569 6:134052833-134052855 CTTTGAAAAGAGGCAGAGAAAGG + Intergenic
1017490197 6:154938220-154938242 CTGTGCAAATAAACAGAAAAGGG + Intronic
1018243681 6:161802303-161802325 AGGAGCTAAGGGACAGAGAAGGG - Intronic
1018735246 6:166682860-166682882 CTTTGAGAAGAAACAGAGAAGGG - Intronic
1019143760 6:169963806-169963828 CTGTGCCCAGAGACCGGGAAGGG - Intergenic
1019552413 7:1609791-1609813 CTGTGGTAGGAGACTGAGTAAGG + Intergenic
1020828129 7:13057916-13057938 CTGAGCAAAGTGAAAGAGAAAGG - Intergenic
1021081713 7:16372724-16372746 CTGTATTAAAAGACACAGAATGG + Intronic
1021157442 7:17229168-17229190 TTCTGACAAGAGACAGAGAATGG + Intergenic
1021333523 7:19369186-19369208 CTGTGAAAACAGACATAGAATGG - Intergenic
1022101621 7:27172768-27172790 CTGAGCTGAGAGCCAGAGAAGGG - Intronic
1022311037 7:29195569-29195591 ATGTGCCAAGAGTCAGAGGATGG - Intronic
1022384989 7:29891501-29891523 CTGAGTTGAGAGAGAGAGAAAGG + Intronic
1022516630 7:30978886-30978908 CAGGGCTAAAAGGCAGAGAAAGG + Intronic
1023561783 7:41481851-41481873 CTGTGCTGAGAGAAAGACATGGG + Intergenic
1023610565 7:41966636-41966658 GTGTGCCTGGAGACAGAGAAAGG + Exonic
1025160320 7:56653763-56653785 CTGTGATAAAGGACAAAGAAAGG - Intergenic
1025726409 7:64065424-64065446 CTGTGATAAAAGACAAACAAAGG + Intronic
1025770840 7:64504686-64504708 CTCTGCAAAGACACAGAAAAAGG + Intergenic
1026054549 7:66973058-66973080 ATTTGCTACGAGACAGAGGAAGG + Intergenic
1026184294 7:68070010-68070032 CTGTGGTAAGACACAGTGATGGG + Intergenic
1026722590 7:72844978-72845000 ATTTGCTACGAGACAGAGGAAGG - Intergenic
1026949364 7:74337296-74337318 CTGTCCCAAGAGAGACAGAAGGG + Intronic
1028093407 7:86730960-86730982 CCGGGCTAGGAGACAGAGCAGGG - Intronic
1028341958 7:89733147-89733169 GTTTGCCAAGAGACAGAGGAAGG - Intergenic
1028848814 7:95513327-95513349 GTGTGTTCAGAGACAGGGAATGG + Intronic
1028896844 7:96050948-96050970 ATGTGCTAAGATACAGTAAAAGG - Intronic
1029442202 7:100593154-100593176 CTAGACTAGGAGACAGAGAAGGG - Intronic
1029628263 7:101734039-101734061 CTGTGCTGAGAGCCAGGGCAGGG - Intergenic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1032262011 7:130345998-130346020 CTGGACTTAGAGACAGAGACTGG - Intronic
1033027679 7:137792132-137792154 CTGTGCTATGAAACACAGACAGG + Intronic
1034987429 7:155525061-155525083 AAGTGCTGAGAGAGAGAGAAAGG - Intronic
1035050803 7:155998169-155998191 CTCTGCTAAGAGGCAGGGCAAGG - Intergenic
1035106680 7:156446845-156446867 CTGTTATAAGCGACAGAAAATGG - Intergenic
1035960771 8:4135040-4135062 CTGTGCTAAGAGTTTAAGAAAGG - Intronic
1036271007 8:7302768-7302790 TTTTCCAAAGAGACAGAGAATGG - Intergenic
1036350342 8:8007576-8007598 TTTTCCAAAGAGACAGAGAATGG + Intergenic
1036845611 8:12168001-12168023 CTTTCCAAAGAGACAGAGAATGG + Intergenic
1036866977 8:12410320-12410342 CTTTCCAAAGAGACAGAGAATGG + Intergenic
1036926451 8:12910913-12910935 CAGTGCTAAGAAAAAGAGTAAGG + Intergenic
1037778617 8:21852134-21852156 CTGTGCTCAGACACAAAAAAGGG - Intergenic
1037849819 8:22318136-22318158 GTGAGCAGAGAGACAGAGAAAGG - Intronic
1038717579 8:30005613-30005635 TTGTAGTAAGAGACAGGGAATGG + Intergenic
1041151383 8:54938648-54938670 CAGTGCTTGGAGATAGAGAAAGG - Intergenic
1041486927 8:58389010-58389032 CTGAGATAATAGACACAGAAGGG + Intergenic
1042190273 8:66178807-66178829 GTGTGCAAAGAGACAGCGAATGG + Intergenic
1042685206 8:71431167-71431189 AAGTGCAAAGAGAAAGAGAAAGG + Intronic
1042963634 8:74328614-74328636 ATGTGCTAGGTGACACAGAAGGG + Intronic
1043872019 8:85443720-85443742 CTATGCTGAGTTACAGAGAATGG - Intronic
1044623465 8:94213605-94213627 ATCTGATAAGAGACAGAGATAGG - Intronic
1044753716 8:95440442-95440464 CTGTGCTATCCGACAGAGTAGGG + Intergenic
1045692259 8:104772150-104772172 CTCTGCTTATAGACAGATAAGGG - Intronic
1045744253 8:105398873-105398895 CTGTGCTGAGATAGAGAGAGAGG + Intronic
1046161016 8:110365000-110365022 GTGTGCAAAGTGACAGATAATGG + Intergenic
1046517039 8:115276177-115276199 CTGTGCTAAGAGACAGGCTATGG - Intergenic
1046880580 8:119302845-119302867 CTGTTTTAAGGGACAGAAAATGG - Intergenic
1047080385 8:121453376-121453398 CTTTTCAAAGAGACAGAGTAGGG + Intergenic
1047415310 8:124660180-124660202 TTGAGCTCAGAGCCAGAGAAGGG - Intronic
1047686060 8:127305646-127305668 CTGTGCTAGGACCCAGAGATCGG + Intergenic
1048091530 8:131246287-131246309 CTTTGCTAGGAGAAAGAGAAAGG + Intergenic
1049528883 8:143143366-143143388 CGGTGCCCAGAGCCAGAGAAGGG + Intergenic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1051173665 9:14343787-14343809 CAGTGCCAAGAAGCAGAGAAAGG + Intronic
1051684816 9:19647031-19647053 GTGTGGAAAGAGAGAGAGAAAGG - Intronic
1052006381 9:23354516-23354538 CTATTCCAAAAGACAGAGAAAGG - Intergenic
1053335538 9:37267427-37267449 CCAGGCTAAGAGACAGAGCAAGG - Intronic
1053803985 9:41783478-41783500 CAGTGGTTAGAGACAGAAAATGG - Intergenic
1054141295 9:61531979-61532001 CAGTGGTTAGAGACAGAAAATGG + Intergenic
1054192288 9:61994976-61994998 CAGTGGTTAGAGACAGAAAATGG - Intergenic
1054460987 9:65462417-65462439 CAGTGGTTAGAGACAGAAAATGG + Intergenic
1054646118 9:67593715-67593737 CAGTGGTTAGAGACAGAAAATGG + Intergenic
1054734943 9:68741663-68741685 CTAAGCAAAGAGATAGAGAAGGG + Intronic
1055668156 9:78572867-78572889 CTGTGCCAAAAGACAGGCAAAGG - Intergenic
1056334431 9:85552563-85552585 CTGTGCTCAGAGAGAGGAAATGG - Intronic
1057189724 9:93079953-93079975 GTGTATTAAGAGAGAGAGAAAGG - Intronic
1057300476 9:93876930-93876952 TTGTTAAAAGAGACAGAGAAGGG + Intergenic
1059568139 9:115404524-115404546 CTGGGCCAAGACACACAGAAAGG + Intergenic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1060835818 9:126754582-126754604 CTGTGCAAAGACTCAGAGGAGGG - Intergenic
1061287423 9:129632002-129632024 CTGTGCTCTGAGCCAGAGGAAGG + Intronic
1062320981 9:135990413-135990435 CTGGGATAACAGACAGAGAAGGG - Intergenic
1062680801 9:137778914-137778936 CAGTAGCAAGAGACAGAGAAGGG + Intronic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1186096014 X:6102609-6102631 CTGAACTAAGAGAGAGAGAGAGG + Intronic
1186108326 X:6228829-6228851 CTGTGCTAAGAGACAGAGAAGGG + Exonic
1186337262 X:8603786-8603808 CTTTGCAAAGAGTCAGGGAATGG + Intronic
1186940702 X:14504308-14504330 ATGTGATTAGAGACAGAAAATGG - Intergenic
1187244240 X:17539568-17539590 ATGTGCTAGGAGCTAGAGAAGGG - Intronic
1188801471 X:34536300-34536322 CTGTAGTAAGAAACAGAAAATGG + Intergenic
1190503262 X:51099870-51099892 ATCTGCTAAGGGCCAGAGAAGGG + Intergenic
1190753824 X:53383544-53383566 CTGGGCTGAGAGCCAGAGAGGGG - Intronic
1192037113 X:67575618-67575640 CTGTACTCAGATACTGAGAAGGG + Intronic
1193968151 X:88015541-88015563 CTCTTCTAGTAGACAGAGAAAGG + Intergenic
1194153027 X:90349909-90349931 ATGTTTTAAGAGACAGACAAAGG - Intergenic
1194177406 X:90667230-90667252 ATGGGCTAAAAGACACAGAATGG + Intergenic
1196143255 X:112289083-112289105 CTGTGATAAGAGACACAATAAGG - Intergenic
1196641296 X:118065359-118065381 CAGTTCTCAGAGACTGAGAAGGG - Intronic
1198517643 X:137425587-137425609 CTCTGCTAAGTGACAAAGACAGG - Intergenic
1199274040 X:145921664-145921686 ATGGCCTAAGGGACAGAGAATGG + Intergenic
1199493352 X:148425792-148425814 ATGGGCTAAGAGGCAAAGAAGGG - Intergenic
1200391700 X:155952112-155952134 CAGTTCTTAGAGATAGAGAAAGG + Intergenic
1200499371 Y:3926711-3926733 ATGTTTTAAGAGACAGACAAAGG - Intergenic
1200524081 Y:4249376-4249398 ATGGGCTAAAAGACACAGAATGG + Intergenic
1200638783 Y:5691006-5691028 CTGAGCCTAGTGACAGAGAAAGG - Intronic
1201489071 Y:14522632-14522654 CTGTACTAACAGACAGAGATGGG - Intronic