ID: 1186111849

View in Genome Browser
Species Human (GRCh38)
Location X:6266161-6266183
Sequence GGGACAAATTGGCCCTCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186111849_1186111859 11 Left 1186111849 X:6266161-6266183 CCACACGAGGGCCAATTTGTCCC No data
Right 1186111859 X:6266195-6266217 TTCTCCAGGACCCAGAGCATGGG No data
1186111849_1186111856 -3 Left 1186111849 X:6266161-6266183 CCACACGAGGGCCAATTTGTCCC No data
Right 1186111856 X:6266181-6266203 CCCAGAGGGGGAATTTCTCCAGG No data
1186111849_1186111858 10 Left 1186111849 X:6266161-6266183 CCACACGAGGGCCAATTTGTCCC No data
Right 1186111858 X:6266194-6266216 TTTCTCCAGGACCCAGAGCATGG No data
1186111849_1186111862 19 Left 1186111849 X:6266161-6266183 CCACACGAGGGCCAATTTGTCCC No data
Right 1186111862 X:6266203-6266225 GACCCAGAGCATGGGATTGCGGG No data
1186111849_1186111863 20 Left 1186111849 X:6266161-6266183 CCACACGAGGGCCAATTTGTCCC No data
Right 1186111863 X:6266204-6266226 ACCCAGAGCATGGGATTGCGGGG No data
1186111849_1186111861 18 Left 1186111849 X:6266161-6266183 CCACACGAGGGCCAATTTGTCCC No data
Right 1186111861 X:6266202-6266224 GGACCCAGAGCATGGGATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186111849 Original CRISPR GGGACAAATTGGCCCTCGTG TGG (reversed) Intergenic
No off target data available for this crispr