ID: 1186112089

View in Genome Browser
Species Human (GRCh38)
Location X:6269200-6269222
Sequence GTGTGTGAGGGGAAGGTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186112089_1186112095 21 Left 1186112089 X:6269200-6269222 CCGCTCACCTTCCCCTCACACAC No data
Right 1186112095 X:6269244-6269266 TGCGTGCACAATCTTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186112089 Original CRISPR GTGTGTGAGGGGAAGGTGAG CGG (reversed) Intergenic
No off target data available for this crispr