ID: 1186121217

View in Genome Browser
Species Human (GRCh38)
Location X:6363260-6363282
Sequence CCATTTAAGTAGCTCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186121217_1186121222 5 Left 1186121217 X:6363260-6363282 CCATGCAGGAGCTACTTAAATGG No data
Right 1186121222 X:6363288-6363310 GGGCTATTAGTGCCTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186121217 Original CRISPR CCATTTAAGTAGCTCCTGCA TGG (reversed) Intergenic
No off target data available for this crispr