ID: 1186125578

View in Genome Browser
Species Human (GRCh38)
Location X:6410221-6410243
Sequence CTATGAGGCAATTGCTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186125574_1186125578 17 Left 1186125574 X:6410181-6410203 CCTGGGTGCTGGCTTCTCAGATG No data
Right 1186125578 X:6410221-6410243 CTATGAGGCAATTGCTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186125578 Original CRISPR CTATGAGGCAATTGCTGATA AGG Intergenic
No off target data available for this crispr