ID: 1186126716

View in Genome Browser
Species Human (GRCh38)
Location X:6422324-6422346
Sequence ATGCGTGTGGAGCCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186126710_1186126716 6 Left 1186126710 X:6422295-6422317 CCTGTCGTCTCACAGTCCTGGCT 0: 1
1: 0
2: 3
3: 8
4: 134
Right 1186126716 X:6422324-6422346 ATGCGTGTGGAGCCCTCCCAGGG 0: 1
1: 0
2: 4
3: 2
4: 108
1186126711_1186126716 -10 Left 1186126711 X:6422311-6422333 CCTGGCTCGCCCAATGCGTGTGG 0: 1
1: 1
2: 3
3: 1
4: 35
Right 1186126716 X:6422324-6422346 ATGCGTGTGGAGCCCTCCCAGGG 0: 1
1: 0
2: 4
3: 2
4: 108
1186126708_1186126716 12 Left 1186126708 X:6422289-6422311 CCACAGCCTGTCGTCTCACAGTC 0: 3
1: 2
2: 1
3: 17
4: 140
Right 1186126716 X:6422324-6422346 ATGCGTGTGGAGCCCTCCCAGGG 0: 1
1: 0
2: 4
3: 2
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186126716 Original CRISPR ATGCGTGTGGAGCCCTCCCA GGG Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
902968489 1:20029600-20029622 ATGGGAGTGGAGCCCTACCGGGG + Intronic
904312823 1:29640352-29640374 ACACTTGTGGAGCCCTTCCAGGG + Intergenic
905361619 1:37424770-37424792 ATCCCTGTTCAGCCCTCCCATGG + Intergenic
917099583 1:171431770-171431792 TTGAGGGTGGAGCCCTCCCTGGG + Intergenic
921202939 1:212824377-212824399 ATACGTATGGAGTCCTCCCGGGG - Intergenic
923628736 1:235635558-235635580 ATGGGGGTGGAGCCCTCCTGAGG + Intronic
1063016998 10:2088278-2088300 GAGACTGTGGAGCCCTCCCAAGG + Intergenic
1063031593 10:2240633-2240655 ATGCGTGTGGAGTCCTAACGGGG - Intergenic
1068607851 10:59025922-59025944 CTGGGGGTGGAGCCCTCCCCAGG - Intergenic
1074645609 10:115449066-115449088 TTGAGGGTGGGGCCCTCCCAGGG - Intronic
1075922741 10:126226397-126226419 ATGCGTGTGCAGCCCTGCGTTGG + Intronic
1077366573 11:2163661-2163683 CTCCGTGGGGTGCCCTCCCAAGG - Intergenic
1077400814 11:2356049-2356071 CTGCGTTTTGGGCCCTCCCAGGG - Intergenic
1077403127 11:2368771-2368793 ATCAGAGTGGTGCCCTCCCATGG - Intergenic
1080037402 11:27723148-27723170 ATGCGTCTGGGGACTTCCCAGGG - Intergenic
1089215149 11:116830508-116830530 ATGCCTCTGGACCCCTCCCTGGG - Intronic
1089710484 11:120311037-120311059 ATGTGGGTGGAGCTCTCCCAGGG + Intronic
1090493981 11:127191910-127191932 ATGCGTGGGGAGGTCTCCAAAGG - Intergenic
1092227514 12:6757495-6757517 ATGCCTCTGGAGCAATCCCAGGG + Intronic
1092696856 12:11181651-11181673 ATGCCTGTGGGCCACTCCCAGGG + Intergenic
1095832574 12:46603584-46603606 ATGCTTGAGGAGCTCTCCAATGG - Intergenic
1096256164 12:50063559-50063581 ACTCCTGTGGACCCCTCCCAGGG - Intronic
1097182801 12:57180619-57180641 CTGGGTGTGGGGCCTTCCCAAGG + Intronic
1103415332 12:120739039-120739061 AGGCCTGTGGAGCCTCCCCATGG - Intronic
1106169794 13:27279437-27279459 GTGGGGGTGGAGCCCTACCAGGG - Intergenic
1110818080 13:79883046-79883068 ATGAGGGTGGAGCCCTAGCAAGG + Intergenic
1113074091 13:106451201-106451223 ATGCGTGTGGTTCCCTCACCTGG + Intergenic
1114568313 14:23648306-23648328 ATGAGTGTGAATCCCTCCTATGG + Intergenic
1116734436 14:48671134-48671156 ATGCCTGCTGACCCCTCCCAGGG + Intergenic
1120824559 14:88943744-88943766 ATGAGGGTGGAGCCCTCGAATGG - Intergenic
1121827930 14:97026142-97026164 AGGTGAGAGGAGCCCTCCCAGGG - Intergenic
1124716998 15:32072952-32072974 ATGGGGTTGGAGCCCTCACATGG + Intronic
1125477653 15:40058315-40058337 ATGGGGGTGGAGCCCGCACAAGG - Intergenic
1128762942 15:70230271-70230293 ATGCCTGTGGAGCTTTCCAATGG + Intergenic
1129181909 15:73882997-73883019 GTGTGTACGGAGCCCTCCCATGG - Intronic
1131061225 15:89405849-89405871 GTGGGTGGGGAGCCCCCCCAAGG + Intergenic
1132955475 16:2590512-2590534 ATGAGTGTGCAGCCATCTCAGGG + Intronic
1134307154 16:13043230-13043252 AGGCCTGTTGAGACCTCCCACGG - Intronic
1142386016 16:89765252-89765274 TTGTGTGTTGTGCCCTCCCAGGG - Intronic
1142386031 16:89765303-89765325 TTGTGTGTTGTGCCCTCCCAAGG - Intronic
1142386045 16:89765354-89765376 TTGTGTGTTGTGCCCTCCCAGGG - Intronic
1143401900 17:6651674-6651696 GCGCGGGTGGAGCCATCCCAGGG - Intergenic
1144043734 17:11436098-11436120 ATGCCTGGGGAGCTCTTCCAGGG + Intronic
1144302802 17:13938773-13938795 CTGAGGGTGGAGCCCTCCCTAGG - Intergenic
1145957960 17:28867915-28867937 ATGCCCCTGGAGCCCTTCCAGGG + Intergenic
1147806519 17:43135566-43135588 ATCCGCGTGGAACCTTCCCATGG + Intergenic
1149620302 17:58039840-58039862 AGACGAGTTGAGCCCTCCCAGGG + Intergenic
1156409223 18:36811711-36811733 AAGAGTGTCGAGCCTTCCCAAGG - Intronic
1157013581 18:43682046-43682068 CTGCGTGTGGTGCCCACCTAAGG - Intergenic
1158689867 18:59650620-59650642 ATGCGTGGTGAGCTTTCCCAGGG - Intronic
1160067370 18:75588546-75588568 AGGCGTGTGGAGCTCTGCCTTGG + Intergenic
1161038040 19:2096329-2096351 ATGCGTGTGGGGCGTTCCCGCGG - Exonic
1168693729 19:58393401-58393423 ATGCGTGTGGAGTCCTCCCGGGG - Exonic
930533141 2:52615143-52615165 TTGAGTGTGGAGCCCTCGCCAGG - Intergenic
933140951 2:78792537-78792559 CTGAGGGTGGAGCCCTCCCCAGG + Intergenic
933228378 2:79777528-79777550 ATGCAGGTGGAGTGCTCCCAAGG + Intronic
939776189 2:146390962-146390984 TTGAGGGTGGAGCCCTCACAGGG + Intergenic
947740792 2:232483939-232483961 CTGAGGGTGGAGCCCTCCCGAGG - Intronic
947822957 2:233084808-233084830 ATGGCTGTGGAGCCCACACAGGG - Intronic
948806316 2:240454817-240454839 GTGGCTCTGGAGCCCTCCCAAGG - Intronic
1169034247 20:2436580-2436602 ATGTGTCTGGAGCCATCACAAGG - Intergenic
1172140120 20:32716814-32716836 ATTCATGTGGACCCCACCCATGG - Intronic
1175916094 20:62426730-62426752 ATGCGTGTGCAGCTGTCCCGGGG - Intronic
1178544566 21:33481812-33481834 ATGCATGTGGAGTCCTCCCAGGG + Intergenic
1180764765 22:18339974-18339996 TTGCCTGTGGCCCCCTCCCAGGG + Intergenic
1180814264 22:18779710-18779732 TTGCCTGTGGCCCCCTCCCAGGG - Intergenic
1181045949 22:20214339-20214361 TTGCCTGTGGGACCCTCCCATGG + Intergenic
1181200450 22:21214045-21214067 TTGCCTGTGGCCCCCTCCCAGGG - Intronic
1181701288 22:24622914-24622936 TTGCCTGTGGCCCCCTCCCAGGG + Intronic
1184545398 22:45164092-45164114 CAGCGTGAGGAGCCCCCCCAGGG + Exonic
1185128238 22:49023504-49023526 ACCCGAGTGGAGCCCTCTCAAGG + Intergenic
1203226388 22_KI270731v1_random:80879-80901 TTGCCTGTGGCCCCCTCCCAGGG + Intergenic
1203264363 22_KI270734v1_random:5397-5419 TTGCCTGTGGCCCCCTCCCAGGG - Intergenic
950842682 3:15982837-15982859 ATGCGAATGGTGCCATCCCAAGG + Intergenic
950930364 3:16783265-16783287 ATGAGGGTGGAGCCCTCACCAGG - Intergenic
954795242 3:53158067-53158089 AGGAGTCTGGAGGCCTCCCAGGG + Intronic
959735638 3:109654996-109655018 TTCAGGGTGGAGCCCTCCCAGGG - Intergenic
969526688 4:7707464-7707486 GTGAGTGTGGACCCCTCTCAGGG + Intronic
980619547 4:135281448-135281470 ATGTTTGTGGAGCCTCCCCATGG - Intergenic
983658680 4:170109795-170109817 AAGCATGTGGAGCCTTTCCAAGG + Intergenic
985386432 4:189452699-189452721 ATGCAAGTGGAGGGCTCCCAAGG - Intergenic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
986160023 5:5219087-5219109 CTGAGTGTGGAGCCCTCTCCAGG + Intronic
986734310 5:10656771-10656793 ATGCCTGGGGAGCTCTTCCAGGG - Intergenic
1001940062 5:175733993-175734015 GTGGGGGTGGAGCCCTACCAGGG - Intergenic
1003080398 6:3016762-3016784 ATGCGTGTGGACACCCTCCAGGG - Intronic
1006167016 6:32071039-32071061 CTGCCTGAGGAGCCATCCCAGGG + Intronic
1007477715 6:42130092-42130114 CTCCGTGTGCTGCCCTCCCAAGG + Intronic
1013991479 6:116258733-116258755 ATGCGTGTGGAGTCCTCCCGGGG + Intronic
1014717902 6:124887457-124887479 ATGGGGGTGGAGCCCTACCCAGG - Intergenic
1016845709 6:148566179-148566201 ATACCTGTGGAGCCCTGGCATGG - Intergenic
1016845952 6:148568914-148568936 ATACTTGTGGAGCCCTGGCACGG + Intergenic
1018239096 6:161754596-161754618 ATGGGGGCTGAGCCCTCCCATGG + Intronic
1024667330 7:51559745-51559767 ATGCATGAGGTGGCCTCCCATGG - Intergenic
1025198014 7:56946987-56947009 AGGTGTGCGGAGCCCACCCAGGG - Intergenic
1025247015 7:57325177-57325199 CAGCCTGAGGAGCCCTCCCATGG - Intergenic
1025673935 7:63629950-63629972 AGGTGTGCGGAGCCCACCCAGGG + Intergenic
1029224158 7:99012934-99012956 ATGCGTGTGGCGCTCCCGCAGGG - Exonic
1036217522 8:6892991-6893013 ATGCCTGGGGAACCCTGCCAAGG + Intergenic
1038494916 8:27994574-27994596 ATGAGCGTGGAGTCCTCACATGG - Intergenic
1040599012 8:48866077-48866099 GTGTGTGTGGAGTCCTCCTAAGG - Intergenic
1043443966 8:80301227-80301249 GTGAGTGTGGAGTCCTCCCGGGG - Intergenic
1049391667 8:142374870-142374892 ATGTGTGTGGGGTCTTCCCAGGG - Intronic
1049573457 8:143380068-143380090 GTGCGTGGGGAGCTCTCCCTCGG - Exonic
1050355807 9:4781694-4781716 ATGCATGTGGAGTCCTCCCAGGG + Intergenic
1060055350 9:120408467-120408489 ATGCCTGTGGGGCCTTCTCAGGG - Exonic
1061887711 9:133601021-133601043 AGGCGGGTAGGGCCCTCCCAGGG - Intergenic
1062463594 9:136671830-136671852 AGGCTTGTGGAGCCCTTCCCAGG + Intronic
1186126716 X:6422324-6422346 ATGCGTGTGGAGCCCTCCCAGGG + Intergenic
1187069533 X:15874537-15874559 ATGCCTGTGGAGCCCTTCCTTGG + Intergenic
1190168414 X:48092323-48092345 ATCCATGGAGAGCCCTCCCAAGG + Intergenic
1190168829 X:48095362-48095384 ATCCATGGAGAGCCCTCCCAAGG - Intergenic
1195906976 X:109853668-109853690 ATATATGTGGAGTCCTCCCAGGG - Intergenic
1201339883 Y:12923047-12923069 ATGAGGTTGGAGCCCTCTCAAGG + Intergenic