ID: 1186130004

View in Genome Browser
Species Human (GRCh38)
Location X:6456259-6456281
Sequence CAGCCCTAAAGCTCAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186130001_1186130004 12 Left 1186130001 X:6456224-6456246 CCATTTGCTTAAAACAATGGATA No data
Right 1186130004 X:6456259-6456281 CAGCCCTAAAGCTCAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186130004 Original CRISPR CAGCCCTAAAGCTCAGAAGT TGG Intergenic
No off target data available for this crispr