ID: 1186134558

View in Genome Browser
Species Human (GRCh38)
Location X:6505401-6505423
Sequence CTGAATACACATATAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186134553_1186134558 21 Left 1186134553 X:6505357-6505379 CCATTTAATTGCTATTGTCCCAT No data
Right 1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG No data
1186134557_1186134558 2 Left 1186134557 X:6505376-6505398 CCATTTGGGTGCATGAAACATTT No data
Right 1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG No data
1186134556_1186134558 3 Left 1186134556 X:6505375-6505397 CCCATTTGGGTGCATGAAACATT No data
Right 1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186134558 Original CRISPR CTGAATACACATATAAAACA TGG Intergenic
No off target data available for this crispr