ID: 1186136810

View in Genome Browser
Species Human (GRCh38)
Location X:6529928-6529950
Sequence ACAGTGGAAGGCCTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186136807_1186136810 27 Left 1186136807 X:6529878-6529900 CCGATAGGCTGCAGCTGCATTTA No data
Right 1186136810 X:6529928-6529950 ACAGTGGAAGGCCTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186136810 Original CRISPR ACAGTGGAAGGCCTTCCCTC TGG Intergenic
No off target data available for this crispr