ID: 1186143524

View in Genome Browser
Species Human (GRCh38)
Location X:6602268-6602290
Sequence GAGTTATGACCCCGGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186143524_1186143533 12 Left 1186143524 X:6602268-6602290 CCACAGTTCCGGGGTCATAACTC No data
Right 1186143533 X:6602303-6602325 CTATAATGTTGGGGTGCTTTTGG No data
1186143524_1186143528 1 Left 1186143524 X:6602268-6602290 CCACAGTTCCGGGGTCATAACTC No data
Right 1186143528 X:6602292-6602314 CATAACCCTTGCTATAATGTTGG No data
1186143524_1186143529 2 Left 1186143524 X:6602268-6602290 CCACAGTTCCGGGGTCATAACTC No data
Right 1186143529 X:6602293-6602315 ATAACCCTTGCTATAATGTTGGG No data
1186143524_1186143530 3 Left 1186143524 X:6602268-6602290 CCACAGTTCCGGGGTCATAACTC No data
Right 1186143530 X:6602294-6602316 TAACCCTTGCTATAATGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186143524 Original CRISPR GAGTTATGACCCCGGAACTG TGG (reversed) Intergenic