ID: 1186148002

View in Genome Browser
Species Human (GRCh38)
Location X:6645085-6645107
Sequence CCTGGGCTGCGATCAATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186148002_1186148011 22 Left 1186148002 X:6645085-6645107 CCCATAATTGATCGCAGCCCAGG No data
Right 1186148011 X:6645130-6645152 TTGAGTAAGTGACCCCAAGGCGG No data
1186148002_1186148009 19 Left 1186148002 X:6645085-6645107 CCCATAATTGATCGCAGCCCAGG No data
Right 1186148009 X:6645127-6645149 GCCTTGAGTAAGTGACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186148002 Original CRISPR CCTGGGCTGCGATCAATTAT GGG (reversed) Intergenic
No off target data available for this crispr