ID: 1186153692

View in Genome Browser
Species Human (GRCh38)
Location X:6703801-6703823
Sequence AGCAATGTATGCTCAGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186153690_1186153692 28 Left 1186153690 X:6703750-6703772 CCATTCAGTAATTTAGTTTTCTG No data
Right 1186153692 X:6703801-6703823 AGCAATGTATGCTCAGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186153692 Original CRISPR AGCAATGTATGCTCAGCTAT TGG Intergenic
No off target data available for this crispr