ID: 1186154020

View in Genome Browser
Species Human (GRCh38)
Location X:6707183-6707205
Sequence CTAGTGAAGGACCCTCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186154020_1186154022 -4 Left 1186154020 X:6707183-6707205 CCTACTAGAGGGTCCTTCACTAG No data
Right 1186154022 X:6707202-6707224 CTAGTAAAAAATTCTACTAGAGG No data
1186154020_1186154024 29 Left 1186154020 X:6707183-6707205 CCTACTAGAGGGTCCTTCACTAG No data
Right 1186154024 X:6707235-6707257 GTGCACCACACTCAGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186154020 Original CRISPR CTAGTGAAGGACCCTCTAGT AGG (reversed) Intergenic
No off target data available for this crispr