ID: 1186154657

View in Genome Browser
Species Human (GRCh38)
Location X:6712619-6712641
Sequence CAGAATCCCCAAGATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186154657_1186154664 17 Left 1186154657 X:6712619-6712641 CCATGTTCATCTTGGGGATTCTG No data
Right 1186154664 X:6712659-6712681 GAAGCAGCCCTCACAGGATCAGG No data
1186154657_1186154663 11 Left 1186154657 X:6712619-6712641 CCATGTTCATCTTGGGGATTCTG No data
Right 1186154663 X:6712653-6712675 ACTGTGGAAGCAGCCCTCACAGG No data
1186154657_1186154661 -5 Left 1186154657 X:6712619-6712641 CCATGTTCATCTTGGGGATTCTG No data
Right 1186154661 X:6712637-6712659 TTCTGGGGAGCCATATACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186154657 Original CRISPR CAGAATCCCCAAGATGAACA TGG (reversed) Intergenic
No off target data available for this crispr