ID: 1186157365

View in Genome Browser
Species Human (GRCh38)
Location X:6739448-6739470
Sequence ATGGCCAAATGTCCCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186157365_1186157368 -5 Left 1186157365 X:6739448-6739470 CCTCTCCAGGGACATTTGGCCAT No data
Right 1186157368 X:6739466-6739488 GCCATGTCTGAGGACATTTTTGG No data
1186157365_1186157370 8 Left 1186157365 X:6739448-6739470 CCTCTCCAGGGACATTTGGCCAT No data
Right 1186157370 X:6739479-6739501 ACATTTTTGGTTGTCGCAACTGG No data
1186157365_1186157371 14 Left 1186157365 X:6739448-6739470 CCTCTCCAGGGACATTTGGCCAT No data
Right 1186157371 X:6739485-6739507 TTGGTTGTCGCAACTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186157365 Original CRISPR ATGGCCAAATGTCCCTGGAG AGG (reversed) Intergenic
No off target data available for this crispr