ID: 1186157366

View in Genome Browser
Species Human (GRCh38)
Location X:6739453-6739475
Sequence CAGACATGGCCAAATGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186157366_1186157371 9 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157371 X:6739485-6739507 TTGGTTGTCGCAACTGGAAATGG No data
1186157366_1186157374 28 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157374 X:6739504-6739526 ATGGCAGAGTGTGTGTGTCGGGG No data
1186157366_1186157373 27 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157373 X:6739503-6739525 AATGGCAGAGTGTGTGTGTCGGG No data
1186157366_1186157372 26 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157372 X:6739502-6739524 AAATGGCAGAGTGTGTGTGTCGG No data
1186157366_1186157368 -10 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157368 X:6739466-6739488 GCCATGTCTGAGGACATTTTTGG No data
1186157366_1186157370 3 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157370 X:6739479-6739501 ACATTTTTGGTTGTCGCAACTGG No data
1186157366_1186157375 29 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157375 X:6739505-6739527 TGGCAGAGTGTGTGTGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186157366 Original CRISPR CAGACATGGCCAAATGTCCC TGG (reversed) Intergenic
No off target data available for this crispr