ID: 1186157369

View in Genome Browser
Species Human (GRCh38)
Location X:6739467-6739489
Sequence ACCAAAAATGTCCTCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186157369_1186157375 15 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157375 X:6739505-6739527 TGGCAGAGTGTGTGTGTCGGGGG No data
1186157369_1186157371 -5 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157371 X:6739485-6739507 TTGGTTGTCGCAACTGGAAATGG No data
1186157369_1186157372 12 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157372 X:6739502-6739524 AAATGGCAGAGTGTGTGTGTCGG No data
1186157369_1186157374 14 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157374 X:6739504-6739526 ATGGCAGAGTGTGTGTGTCGGGG No data
1186157369_1186157373 13 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157373 X:6739503-6739525 AATGGCAGAGTGTGTGTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186157369 Original CRISPR ACCAAAAATGTCCTCAGACA TGG (reversed) Intergenic
No off target data available for this crispr